Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625109_at:

>probe:Drosophila_2:1625109_at:513:389; Interrogation_Position=2068; Antisense; GAAACTGGACGCTCTAAAACCGGTG
>probe:Drosophila_2:1625109_at:690:181; Interrogation_Position=2083; Antisense; AAAACCGGTGGTCATCTGCGGCGAC
>probe:Drosophila_2:1625109_at:315:575; Interrogation_Position=2102; Antisense; GGCGACATGAACGTTTCCCATATGC
>probe:Drosophila_2:1625109_at:135:577; Interrogation_Position=2210; Antisense; GGCCTCGGCTTTGTGGACACGTTTA
>probe:Drosophila_2:1625109_at:235:699; Interrogation_Position=2231; Antisense; TTTAGGCATTTATATCCCGATCGCA
>probe:Drosophila_2:1625109_at:464:313; Interrogation_Position=2261; Antisense; GCCTACACCTTCTGGACATACATGG
>probe:Drosophila_2:1625109_at:439:557; Interrogation_Position=2320; Antisense; GGACTATTGTCTCGTCTCGGAGAGA
>probe:Drosophila_2:1625109_at:652:427; Interrogation_Position=2369; Antisense; GAGATACGCAGCCAATGCCTTGGAA
>probe:Drosophila_2:1625109_at:560:283; Interrogation_Position=2401; Antisense; CTGCCCGATCACAATATTCTTCAAT
>probe:Drosophila_2:1625109_at:658:707; Interrogation_Position=2479; Antisense; TTACTTTGTTTCCTCTCCATATATG
>probe:Drosophila_2:1625109_at:684:481; Interrogation_Position=2513; Antisense; GTATTTGATTATCCATCGCTGTAGA
>probe:Drosophila_2:1625109_at:265:487; Interrogation_Position=2542; Antisense; GTACGTCCCTATCTAATCATTTCAA
>probe:Drosophila_2:1625109_at:427:151; Interrogation_Position=2584; Antisense; ACATTCTGTCATAGATCCACCATCA
>probe:Drosophila_2:1625109_at:656:237; Interrogation_Position=2625; Antisense; AATAAAGTGAGCTACTGCCCCACGT

Paste this into a BLAST search page for me
GAAACTGGACGCTCTAAAACCGGTGAAAACCGGTGGTCATCTGCGGCGACGGCGACATGAACGTTTCCCATATGCGGCCTCGGCTTTGTGGACACGTTTATTTAGGCATTTATATCCCGATCGCAGCCTACACCTTCTGGACATACATGGGGACTATTGTCTCGTCTCGGAGAGAGAGATACGCAGCCAATGCCTTGGAACTGCCCGATCACAATATTCTTCAATTTACTTTGTTTCCTCTCCATATATGGTATTTGATTATCCATCGCTGTAGAGTACGTCCCTATCTAATCATTTCAAACATTCTGTCATAGATCCACCATCAAATAAAGTGAGCTACTGCCCCACGT

Full Affymetrix probeset data:

Annotations for 1625109_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime