FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625110_at:

>probe:Drosophila_2:1625110_at:522:729; Interrogation_Position=1441; Antisense; TTGGATGACTTTAGCCTGACGGTGA
>probe:Drosophila_2:1625110_at:353:309; Interrogation_Position=1503; Antisense; CCAATTGTCGCCTTTATCGTTTAAG
>probe:Drosophila_2:1625110_at:177:201; Interrogation_Position=1538; Antisense; AACGCGGATTTTATCATGTCCTCTG
>probe:Drosophila_2:1625110_at:175:63; Interrogation_Position=1553; Antisense; ATGTCCTCTGACCTATGTATTATTC
>probe:Drosophila_2:1625110_at:267:199; Interrogation_Position=1586; Antisense; AACGAATCAAGCTCGAGATCTGCGC
>probe:Drosophila_2:1625110_at:448:97; Interrogation_Position=1601; Antisense; AGATCTGCGCTCTCGATGAGCCAGT
>probe:Drosophila_2:1625110_at:334:57; Interrogation_Position=1616; Antisense; ATGAGCCAGTCAATTCTTCGTGTCT
>probe:Drosophila_2:1625110_at:4:499; Interrogation_Position=1637; Antisense; GTCTTTGAAGACCAACCAGCCGACT
>probe:Drosophila_2:1625110_at:693:259; Interrogation_Position=1653; Antisense; CAGCCGACTCTCGACTATTTTAAGT
>probe:Drosophila_2:1625110_at:108:73; Interrogation_Position=1687; Antisense; AGGAGCACTCATTCAAGTTTTTCGC
>probe:Drosophila_2:1625110_at:505:695; Interrogation_Position=1706; Antisense; TTTCGCTTTCCCGATTGTTCACAAA
>probe:Drosophila_2:1625110_at:216:173; Interrogation_Position=1728; Antisense; AAACCAACCACCTAGTATGAGCATG
>probe:Drosophila_2:1625110_at:449:203; Interrogation_Position=1769; Antisense; AACCACTGATCATTTTTGCCAGCTC
>probe:Drosophila_2:1625110_at:20:721; Interrogation_Position=1784; Antisense; TTGCCAGCTCTCCATTGACAAACAA

Paste this into a BLAST search page for me
TTGGATGACTTTAGCCTGACGGTGACCAATTGTCGCCTTTATCGTTTAAGAACGCGGATTTTATCATGTCCTCTGATGTCCTCTGACCTATGTATTATTCAACGAATCAAGCTCGAGATCTGCGCAGATCTGCGCTCTCGATGAGCCAGTATGAGCCAGTCAATTCTTCGTGTCTGTCTTTGAAGACCAACCAGCCGACTCAGCCGACTCTCGACTATTTTAAGTAGGAGCACTCATTCAAGTTTTTCGCTTTCGCTTTCCCGATTGTTCACAAAAAACCAACCACCTAGTATGAGCATGAACCACTGATCATTTTTGCCAGCTCTTGCCAGCTCTCCATTGACAAACAA

Full Affymetrix probeset data:

Annotations for 1625110_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720