FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625111_at:

>probe:Drosophila_2:1625111_at:64:469; Interrogation_Position=1282; Antisense; GTTGAGCCCATTTTGTACGAGCGAG
>probe:Drosophila_2:1625111_at:135:671; Interrogation_Position=1297; Antisense; TACGAGCGAGACTTTGCCAAACCAC
>probe:Drosophila_2:1625111_at:12:685; Interrogation_Position=1416; Antisense; TATACCGCCCTCTATTTACATGAAT
>probe:Drosophila_2:1625111_at:619:727; Interrogation_Position=1475; Antisense; TTGGTCAGAATCCTCCAAGGAGCCC
>probe:Drosophila_2:1625111_at:409:75; Interrogation_Position=1492; Antisense; AGGAGCCCCAATCCGCCAAAAAGAT
>probe:Drosophila_2:1625111_at:147:517; Interrogation_Position=1523; Antisense; GTGTGACACCTGTAGGATTCCTTCC
>probe:Drosophila_2:1625111_at:86:477; Interrogation_Position=1589; Antisense; GTTTTGCCCCAGTTCCAATTAAGAG
>probe:Drosophila_2:1625111_at:471:507; Interrogation_Position=1668; Antisense; GGAAAGGGATCCTGAACCACGTCCG
>probe:Drosophila_2:1625111_at:348:17; Interrogation_Position=1722; Antisense; ATTTCATGAGGATGTCCCACTTGCC
>probe:Drosophila_2:1625111_at:251:115; Interrogation_Position=1759; Antisense; AGCTTGGATCCCTGTCAGCAGGAAC
>probe:Drosophila_2:1625111_at:569:561; Interrogation_Position=1779; Antisense; GGAACACGATCATGTCCTTTTTCGC
>probe:Drosophila_2:1625111_at:580:701; Interrogation_Position=1797; Antisense; TTTTCGCCAGAGATCACAGCACCAG
>probe:Drosophila_2:1625111_at:190:37; Interrogation_Position=1829; Antisense; ATCATCATGTAAACTATCCCCTACC
>probe:Drosophila_2:1625111_at:155:689; Interrogation_Position=1857; Antisense; TATTTCCTCGCACTTTTTCACATAA

Paste this into a BLAST search page for me
GTTGAGCCCATTTTGTACGAGCGAGTACGAGCGAGACTTTGCCAAACCACTATACCGCCCTCTATTTACATGAATTTGGTCAGAATCCTCCAAGGAGCCCAGGAGCCCCAATCCGCCAAAAAGATGTGTGACACCTGTAGGATTCCTTCCGTTTTGCCCCAGTTCCAATTAAGAGGGAAAGGGATCCTGAACCACGTCCGATTTCATGAGGATGTCCCACTTGCCAGCTTGGATCCCTGTCAGCAGGAACGGAACACGATCATGTCCTTTTTCGCTTTTCGCCAGAGATCACAGCACCAGATCATCATGTAAACTATCCCCTACCTATTTCCTCGCACTTTTTCACATAA

Full Affymetrix probeset data:

Annotations for 1625111_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720