FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625112_at:

>probe:Drosophila_2:1625112_at:680:425; Interrogation_Position=1023; Antisense; GAGAGTTTGTTACGGCCATTGCCTA
>probe:Drosophila_2:1625112_at:602:117; Interrogation_Position=1062; Antisense; AGCTATCGTGGCACTGTCGAACGTA
>probe:Drosophila_2:1625112_at:546:439; Interrogation_Position=1097; Antisense; GAGGCCCCTCTATCAACGATTGATG
>probe:Drosophila_2:1625112_at:392:197; Interrogation_Position=1111; Antisense; AACGATTGATGTGCCCTTCCGGAAT
>probe:Drosophila_2:1625112_at:692:677; Interrogation_Position=1167; Antisense; TAGAGACGCTTACCGACGCCGAAAT
>probe:Drosophila_2:1625112_at:23:211; Interrogation_Position=1196; Antisense; AAGAAAATCCGCGACCAGGACCGCA
>probe:Drosophila_2:1625112_at:389:407; Interrogation_Position=1239; Antisense; GACTGGCCAATACCACAACTGGTTG
>probe:Drosophila_2:1625112_at:68:195; Interrogation_Position=1255; Antisense; AACTGGTTGGTGATCTTCCGCCGAT
>probe:Drosophila_2:1625112_at:407:515; Interrogation_Position=1288; Antisense; GTGTCACTAATGTAATCCTCCTATT
>probe:Drosophila_2:1625112_at:275:689; Interrogation_Position=814; Antisense; TATTGCACAGGCCATCCGACAGCAG
>probe:Drosophila_2:1625112_at:49:399; Interrogation_Position=831; Antisense; GACAGCAGATCGAAGCCTTTCCCAA
>probe:Drosophila_2:1625112_at:329:613; Interrogation_Position=906; Antisense; TGAACATTCACGTGGGCAACACCTC
>probe:Drosophila_2:1625112_at:578:159; Interrogation_Position=969; Antisense; ACAACAACCCCGAGGAGTTTGCCAT
>probe:Drosophila_2:1625112_at:129:695; Interrogation_Position=986; Antisense; TTTGCCATTAAACTCTGTGCGGAAT

Paste this into a BLAST search page for me
GAGAGTTTGTTACGGCCATTGCCTAAGCTATCGTGGCACTGTCGAACGTAGAGGCCCCTCTATCAACGATTGATGAACGATTGATGTGCCCTTCCGGAATTAGAGACGCTTACCGACGCCGAAATAAGAAAATCCGCGACCAGGACCGCAGACTGGCCAATACCACAACTGGTTGAACTGGTTGGTGATCTTCCGCCGATGTGTCACTAATGTAATCCTCCTATTTATTGCACAGGCCATCCGACAGCAGGACAGCAGATCGAAGCCTTTCCCAATGAACATTCACGTGGGCAACACCTCACAACAACCCCGAGGAGTTTGCCATTTTGCCATTAAACTCTGTGCGGAAT

Full Affymetrix probeset data:

Annotations for 1625112_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720