Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625114_at:

>probe:Drosophila_2:1625114_at:50:391; Interrogation_Position=1070; Antisense; GAAACTCTTCGCAAATATCCACCTC
>probe:Drosophila_2:1625114_at:588:23; Interrogation_Position=1084; Antisense; ATATCCACCTCTACCCATTATTGAA
>probe:Drosophila_2:1625114_at:237:271; Interrogation_Position=1099; Antisense; CATTATTGAACGTGTTTGCCGCAAA
>probe:Drosophila_2:1625114_at:176:319; Interrogation_Position=1116; Antisense; GCCGCAAAAGTTATTCGCTACCCAA
>probe:Drosophila_2:1625114_at:141:211; Interrogation_Position=1166; Antisense; AAGACTTTGATGGTGCCTCTACTGG
>probe:Drosophila_2:1625114_at:204:281; Interrogation_Position=1182; Antisense; CTCTACTGGCTATGCACCGAGATGA
>probe:Drosophila_2:1625114_at:38:665; Interrogation_Position=1232; Antisense; TACAAGCCACTTCGATTTCTGCAAA
>probe:Drosophila_2:1625114_at:207:359; Interrogation_Position=1252; Antisense; GCAAACTGCCAACGATGTGGGCCAA
>probe:Drosophila_2:1625114_at:530:465; Interrogation_Position=1357; Antisense; GTTGGTAATTAAAGTGGCCCTGATC
>probe:Drosophila_2:1625114_at:625:445; Interrogation_Position=1412; Antisense; GATGCGAACCAGGTGAAGACCCTTA
>probe:Drosophila_2:1625114_at:310:313; Interrogation_Position=1450; Antisense; GCCAGCTCCTTTTATACACACAAAG
>probe:Drosophila_2:1625114_at:340:723; Interrogation_Position=1562; Antisense; TTGAGCATTTTTTCCAACACTTTGT
>probe:Drosophila_2:1625114_at:528:187; Interrogation_Position=1577; Antisense; AACACTTTGTCGTGTGTGCGCGACA
>probe:Drosophila_2:1625114_at:644:507; Interrogation_Position=1592; Antisense; GTGCGCGACACCTGAAATTATGCTA

Paste this into a BLAST search page for me
GAAACTCTTCGCAAATATCCACCTCATATCCACCTCTACCCATTATTGAACATTATTGAACGTGTTTGCCGCAAAGCCGCAAAAGTTATTCGCTACCCAAAAGACTTTGATGGTGCCTCTACTGGCTCTACTGGCTATGCACCGAGATGATACAAGCCACTTCGATTTCTGCAAAGCAAACTGCCAACGATGTGGGCCAAGTTGGTAATTAAAGTGGCCCTGATCGATGCGAACCAGGTGAAGACCCTTAGCCAGCTCCTTTTATACACACAAAGTTGAGCATTTTTTCCAACACTTTGTAACACTTTGTCGTGTGTGCGCGACAGTGCGCGACACCTGAAATTATGCTA

Full Affymetrix probeset data:

Annotations for 1625114_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime