FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625115_at:

>probe:Drosophila_2:1625115_at:125:423; Interrogation_Position=3729; Antisense; GAGAACCTTCAGCTGTACAGCGAAA
>probe:Drosophila_2:1625115_at:13:13; Interrogation_Position=3761; Antisense; ATTAAAGGTGCGCATCGCGGCCTTG
>probe:Drosophila_2:1625115_at:362:633; Interrogation_Position=3775; Antisense; TCGCGGCCTTGGAACAGCAGATTGG
>probe:Drosophila_2:1625115_at:111:39; Interrogation_Position=3802; Antisense; ATCTCAAGGCGCAGGGCTCCGACGA
>probe:Drosophila_2:1625115_at:250:97; Interrogation_Position=3854; Antisense; ACTAAGATCGCAGCATTACCGGTAT
>probe:Drosophila_2:1625115_at:39:637; Interrogation_Position=3884; Antisense; TCTGGCCCGCGAAAAGGAACTCTTT
>probe:Drosophila_2:1625115_at:628:193; Interrogation_Position=3901; Antisense; AACTCTTTAGGAAGCGTTGGCGCAG
>probe:Drosophila_2:1625115_at:23:433; Interrogation_Position=4000; Antisense; GAGTCGAACCCATTGACCTTCGAAA
>probe:Drosophila_2:1625115_at:254:429; Interrogation_Position=4059; Antisense; GAGTACGGACAGTTTCGCCAGAATG
>probe:Drosophila_2:1625115_at:105:599; Interrogation_Position=4087; Antisense; TGTCTCCAAGATATACCCTCAATTC
>probe:Drosophila_2:1625115_at:659:653; Interrogation_Position=4105; Antisense; TCAATTCGCTGTCCGGATCGGGTGA
>probe:Drosophila_2:1625115_at:529:511; Interrogation_Position=4126; Antisense; GTGACTTTGCGCCTCCAAACAGAAA
>probe:Drosophila_2:1625115_at:182:393; Interrogation_Position=4147; Antisense; GAAAGCGTATGGTGGCGGCCCATAA
>probe:Drosophila_2:1625115_at:226:457; Interrogation_Position=4180; Antisense; GATACGATCCATTCGATTTTACCAA

Paste this into a BLAST search page for me
GAGAACCTTCAGCTGTACAGCGAAAATTAAAGGTGCGCATCGCGGCCTTGTCGCGGCCTTGGAACAGCAGATTGGATCTCAAGGCGCAGGGCTCCGACGAACTAAGATCGCAGCATTACCGGTATTCTGGCCCGCGAAAAGGAACTCTTTAACTCTTTAGGAAGCGTTGGCGCAGGAGTCGAACCCATTGACCTTCGAAAGAGTACGGACAGTTTCGCCAGAATGTGTCTCCAAGATATACCCTCAATTCTCAATTCGCTGTCCGGATCGGGTGAGTGACTTTGCGCCTCCAAACAGAAAGAAAGCGTATGGTGGCGGCCCATAAGATACGATCCATTCGATTTTACCAA

Full Affymetrix probeset data:

Annotations for 1625115_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720