Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625116_at:

>probe:Drosophila_2:1625116_at:236:147; Interrogation_Position=9845; Antisense; ACTTGCAAGTACTAAGTGAGTAATC
>probe:Drosophila_2:1625116_at:197:513; Interrogation_Position=9860; Antisense; GTGAGTAATCGCTACACGTTAGGTT
>probe:Drosophila_2:1625116_at:537:277; Interrogation_Position=9871; Antisense; CTACACGTTAGGTTTTCTGAGGCAC
>probe:Drosophila_2:1625116_at:618:675; Interrogation_Position=9879; Antisense; TAGGTTTTCTGAGGCACCGGTATCT
>probe:Drosophila_2:1625116_at:488:699; Interrogation_Position=9883; Antisense; TTTTCTGAGGCACCGGTATCTCCGA
>probe:Drosophila_2:1625116_at:23:539; Interrogation_Position=9897; Antisense; GGTATCTCCGACTCCGGTTTAGAGG
>probe:Drosophila_2:1625116_at:110:627; Interrogation_Position=9901; Antisense; TCTCCGACTCCGGTTTAGAGGTGGA
>probe:Drosophila_2:1625116_at:354:699; Interrogation_Position=9914; Antisense; TTTAGAGGTGGAGTCGGGTCCGCCG
>probe:Drosophila_2:1625116_at:157:301; Interrogation_Position=9934; Antisense; CGCCGGTTCGCAGTCAGAAGATGTC
>probe:Drosophila_2:1625116_at:664:297; Interrogation_Position=9942; Antisense; CGCAGTCAGAAGATGTCGAGTCCGA
>probe:Drosophila_2:1625116_at:18:63; Interrogation_Position=9954; Antisense; ATGTCGAGTCCGACAAGCCACCTTA
>probe:Drosophila_2:1625116_at:370:397; Interrogation_Position=9965; Antisense; GACAAGCCACCTTACTTCCATTTCG
>probe:Drosophila_2:1625116_at:182:709; Interrogation_Position=9976; Antisense; TTACTTCCATTTCGCCCCTGAAAAG
>probe:Drosophila_2:1625116_at:645:629; Interrogation_Position=9981; Antisense; TCCATTTCGCCCCTGAAAAGAAAGA

Paste this into a BLAST search page for me
ACTTGCAAGTACTAAGTGAGTAATCGTGAGTAATCGCTACACGTTAGGTTCTACACGTTAGGTTTTCTGAGGCACTAGGTTTTCTGAGGCACCGGTATCTTTTTCTGAGGCACCGGTATCTCCGAGGTATCTCCGACTCCGGTTTAGAGGTCTCCGACTCCGGTTTAGAGGTGGATTTAGAGGTGGAGTCGGGTCCGCCGCGCCGGTTCGCAGTCAGAAGATGTCCGCAGTCAGAAGATGTCGAGTCCGAATGTCGAGTCCGACAAGCCACCTTAGACAAGCCACCTTACTTCCATTTCGTTACTTCCATTTCGCCCCTGAAAAGTCCATTTCGCCCCTGAAAAGAAAGA

Full Affymetrix probeset data:

Annotations for 1625116_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime