Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625117_at:

>probe:Drosophila_2:1625117_at:695:59; Interrogation_Position=6356; Antisense; ATGTGCGCGAAACAAGCCCGCCAAG
>probe:Drosophila_2:1625117_at:619:563; Interrogation_Position=6410; Antisense; GGCAGCAGTTACTCCTGTCTTGGAG
>probe:Drosophila_2:1625117_at:208:197; Interrogation_Position=6449; Antisense; AACGGATGACAGTCCGATGCCCAGT
>probe:Drosophila_2:1625117_at:97:197; Interrogation_Position=6512; Antisense; AACGGCGGCACTGAGTCCAAAGGCA
>probe:Drosophila_2:1625117_at:642:169; Interrogation_Position=6530; Antisense; AAAGGCAGCTGTGCCCGTGGCATCG
>probe:Drosophila_2:1625117_at:344:473; Interrogation_Position=6564; Antisense; GTTCTTGAAGCGACGACGGTGACCA
>probe:Drosophila_2:1625117_at:441:141; Interrogation_Position=6614; Antisense; ACGGCAGGCGGGTAATGCTGTCAAT
>probe:Drosophila_2:1625117_at:95:255; Interrogation_Position=6674; Antisense; CAACTTCAGCGGGAACGGAGTCACC
>probe:Drosophila_2:1625117_at:415:135; Interrogation_Position=6703; Antisense; ACGCGGCGAATGTCACTGCAACGGG
>probe:Drosophila_2:1625117_at:561:529; Interrogation_Position=6805; Antisense; GGGTCATACGTTATTGTGCCAAGCG
>probe:Drosophila_2:1625117_at:327:497; Interrogation_Position=6820; Antisense; GTGCCAAGCGTACTCTAACGGACTT
>probe:Drosophila_2:1625117_at:453:557; Interrogation_Position=6839; Antisense; GGACTTATAGTAAGCGCCGGACGCG
>probe:Drosophila_2:1625117_at:684:251; Interrogation_Position=6877; Antisense; CAAGCCGCCTCCAAAGTGGTCGTAA
>probe:Drosophila_2:1625117_at:241:583; Interrogation_Position=6893; Antisense; TGGTCGTAACCACAGAGCACAGCCG

Paste this into a BLAST search page for me
ATGTGCGCGAAACAAGCCCGCCAAGGGCAGCAGTTACTCCTGTCTTGGAGAACGGATGACAGTCCGATGCCCAGTAACGGCGGCACTGAGTCCAAAGGCAAAAGGCAGCTGTGCCCGTGGCATCGGTTCTTGAAGCGACGACGGTGACCAACGGCAGGCGGGTAATGCTGTCAATCAACTTCAGCGGGAACGGAGTCACCACGCGGCGAATGTCACTGCAACGGGGGGTCATACGTTATTGTGCCAAGCGGTGCCAAGCGTACTCTAACGGACTTGGACTTATAGTAAGCGCCGGACGCGCAAGCCGCCTCCAAAGTGGTCGTAATGGTCGTAACCACAGAGCACAGCCG

Full Affymetrix probeset data:

Annotations for 1625117_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime