FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625119_at:

>probe:Drosophila_2:1625119_at:667:339; Interrogation_Position=2964; Antisense; GCTAAATCTGAGCTTCGCCGAGCAA
>probe:Drosophila_2:1625119_at:339:543; Interrogation_Position=2997; Antisense; GGATTCGATTGGTGGCACGCCGACC
>probe:Drosophila_2:1625119_at:285:45; Interrogation_Position=3039; Antisense; ATCGCTGCACAGTGAGGATGCCACA
>probe:Drosophila_2:1625119_at:259:331; Interrogation_Position=3079; Antisense; GCGGATATCCTAGGGCAGCATCAGA
>probe:Drosophila_2:1625119_at:187:103; Interrogation_Position=3101; Antisense; AGAGCTTTGCTCTCTTTAATCCCAG
>probe:Drosophila_2:1625119_at:197:707; Interrogation_Position=3116; Antisense; TTAATCCCAGAGAGCGTACGACCAG
>probe:Drosophila_2:1625119_at:11:177; Interrogation_Position=3174; Antisense; AAACGCCTTATCCAGTGATTTCAAG
>probe:Drosophila_2:1625119_at:355:691; Interrogation_Position=3204; Antisense; TTTGCTAACGCGCAGTGTTCTTACC
>probe:Drosophila_2:1625119_at:420:313; Interrogation_Position=3229; Antisense; GCCAGTCCGGCTGATTTATCATTTG
>probe:Drosophila_2:1625119_at:494:703; Interrogation_Position=3244; Antisense; TTATCATTTGCCAGTCGGTCGGATG
>probe:Drosophila_2:1625119_at:41:621; Interrogation_Position=3335; Antisense; TGCTCTACTGCCTGGACGGAAATGA
>probe:Drosophila_2:1625119_at:721:87; Interrogation_Position=3425; Antisense; AGTCTACGCTAATTACCAACCTTGA
>probe:Drosophila_2:1625119_at:446:667; Interrogation_Position=3479; Antisense; TACAGGAGGATCATTCGCGCACCAA
>probe:Drosophila_2:1625119_at:227:183; Interrogation_Position=3503; Antisense; AAAAGCTGCTAATTACTTCTCCCGA

Paste this into a BLAST search page for me
GCTAAATCTGAGCTTCGCCGAGCAAGGATTCGATTGGTGGCACGCCGACCATCGCTGCACAGTGAGGATGCCACAGCGGATATCCTAGGGCAGCATCAGAAGAGCTTTGCTCTCTTTAATCCCAGTTAATCCCAGAGAGCGTACGACCAGAAACGCCTTATCCAGTGATTTCAAGTTTGCTAACGCGCAGTGTTCTTACCGCCAGTCCGGCTGATTTATCATTTGTTATCATTTGCCAGTCGGTCGGATGTGCTCTACTGCCTGGACGGAAATGAAGTCTACGCTAATTACCAACCTTGATACAGGAGGATCATTCGCGCACCAAAAAAGCTGCTAATTACTTCTCCCGA

Full Affymetrix probeset data:

Annotations for 1625119_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720