FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625120_at:

>probe:Drosophila_2:1625120_at:687:515; Interrogation_Position=1019; Antisense; GTGTCCTGGTACAAAGCCTACGATA
>probe:Drosophila_2:1625120_at:706:453; Interrogation_Position=1040; Antisense; GATAAGTTCCTTGAGATCGCCCAGT
>probe:Drosophila_2:1625120_at:544:429; Interrogation_Position=1076; Antisense; GAGTTCAAGACCCAAGCCGGCGATG
>probe:Drosophila_2:1625120_at:174:443; Interrogation_Position=1097; Antisense; GATGTGTTCGTCTTCAACAACCTGC
>probe:Drosophila_2:1625120_at:705:159; Interrogation_Position=1164; Antisense; ACAAGCGTCATTTGGTGGGCGCCTA
>probe:Drosophila_2:1625120_at:621:321; Interrogation_Position=1182; Antisense; GCGCCTACGTCGACTGGGACATTAT
>probe:Drosophila_2:1625120_at:189:273; Interrogation_Position=1201; Antisense; CATTATTTACTCCAAGCTGCGAACC
>probe:Drosophila_2:1625120_at:106:197; Interrogation_Position=1222; Antisense; AACCCTGAAGTTCCCAAATGCCAAG
>probe:Drosophila_2:1625120_at:535:227; Interrogation_Position=716; Antisense; AAGGCGGGCATCAACATCCTGCACA
>probe:Drosophila_2:1625120_at:176:27; Interrogation_Position=774; Antisense; ATACGCTGACAGATGGCTTCAACGT
>probe:Drosophila_2:1625120_at:172:185; Interrogation_Position=794; Antisense; AACGTGGCCTCGCAGTTGCAAAAAC
>probe:Drosophila_2:1625120_at:654:433; Interrogation_Position=836; Antisense; GAGGTGCTCAAGTCGGTGCCCGTTA
>probe:Drosophila_2:1625120_at:412:535; Interrogation_Position=850; Antisense; GGTGCCCGTTAACTGGTTTGACATC
>probe:Drosophila_2:1625120_at:539:479; Interrogation_Position=865; Antisense; GTTTGACATCGGACACGACGGCGAT

Paste this into a BLAST search page for me
GTGTCCTGGTACAAAGCCTACGATAGATAAGTTCCTTGAGATCGCCCAGTGAGTTCAAGACCCAAGCCGGCGATGGATGTGTTCGTCTTCAACAACCTGCACAAGCGTCATTTGGTGGGCGCCTAGCGCCTACGTCGACTGGGACATTATCATTATTTACTCCAAGCTGCGAACCAACCCTGAAGTTCCCAAATGCCAAGAAGGCGGGCATCAACATCCTGCACAATACGCTGACAGATGGCTTCAACGTAACGTGGCCTCGCAGTTGCAAAAACGAGGTGCTCAAGTCGGTGCCCGTTAGGTGCCCGTTAACTGGTTTGACATCGTTTGACATCGGACACGACGGCGAT

Full Affymetrix probeset data:

Annotations for 1625120_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720