FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625122_at:

>probe:Drosophila_2:1625122_at:82:51; Interrogation_Position=118; Antisense; ATGCCGATGACTGGACGCCCAAGAC
>probe:Drosophila_2:1625122_at:138:185; Interrogation_Position=159; Antisense; AAAATCCGCGTTGATTGCCTCAAGG
>probe:Drosophila_2:1625122_at:467:421; Interrogation_Position=183; Antisense; GAGAATCCGCTGAGCAACGACCAGA
>probe:Drosophila_2:1625122_at:515:643; Interrogation_Position=208; Antisense; TCTCCCAGCTGAAGAACCTGATCTT
>probe:Drosophila_2:1625122_at:624:593; Interrogation_Position=283; Antisense; TGGGCATCTTCTGCGACCAACAGGG
>probe:Drosophila_2:1625122_at:75:351; Interrogation_Position=332; Antisense; GCAGTTCAAGATGGACCTGTCCGAG
>probe:Drosophila_2:1625122_at:643:317; Interrogation_Position=35; Antisense; GCCGCGATCGTGCAACTATAACTAA
>probe:Drosophila_2:1625122_at:85:97; Interrogation_Position=370; Antisense; AGATCGCCCAGAGCTGCGTGGACGA
>probe:Drosophila_2:1625122_at:527:63; Interrogation_Position=418; Antisense; ATGTGTGGGCCTTTCGCGGACACCA
>probe:Drosophila_2:1625122_at:298:559; Interrogation_Position=435; Antisense; GGACACCAGTGCATGATGGCCAGTA
>probe:Drosophila_2:1625122_at:244:109; Interrogation_Position=514; Antisense; AGAAGGCCGCCTAGGTCTGAATTTT
>probe:Drosophila_2:1625122_at:695:533; Interrogation_Position=527; Antisense; GGTCTGAATTTTCGGTCTCAACCAA
>probe:Drosophila_2:1625122_at:541:167; Interrogation_Position=554; Antisense; AAATGTGTTCATCTCTATGCTGAAA
>probe:Drosophila_2:1625122_at:688:217; Interrogation_Position=78; Antisense; AAGTATCTGATCGTAGCTCTGGCCC

Paste this into a BLAST search page for me
ATGCCGATGACTGGACGCCCAAGACAAAATCCGCGTTGATTGCCTCAAGGGAGAATCCGCTGAGCAACGACCAGATCTCCCAGCTGAAGAACCTGATCTTTGGGCATCTTCTGCGACCAACAGGGGCAGTTCAAGATGGACCTGTCCGAGGCCGCGATCGTGCAACTATAACTAAAGATCGCCCAGAGCTGCGTGGACGAATGTGTGGGCCTTTCGCGGACACCAGGACACCAGTGCATGATGGCCAGTAAGAAGGCCGCCTAGGTCTGAATTTTGGTCTGAATTTTCGGTCTCAACCAAAAATGTGTTCATCTCTATGCTGAAAAAGTATCTGATCGTAGCTCTGGCCC

Full Affymetrix probeset data:

Annotations for 1625122_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720