Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625124_at:

>probe:Drosophila_2:1625124_at:638:591; Interrogation_Position=674; Antisense; TGGTGCTGGCCTGGGTCTATCTCAT
>probe:Drosophila_2:1625124_at:614:621; Interrogation_Position=677; Antisense; TGCTGGCCTGGGTCTATCTCATCAT
>probe:Drosophila_2:1625124_at:258:581; Interrogation_Position=680; Antisense; TGGCCTGGGTCTATCTCATCATTTC
>probe:Drosophila_2:1625124_at:124:317; Interrogation_Position=682; Antisense; GCCTGGGTCTATCTCATCATTTCGG
>probe:Drosophila_2:1625124_at:276:593; Interrogation_Position=685; Antisense; TGGGTCTATCTCATCATTTCGGCTA
>probe:Drosophila_2:1625124_at:376:537; Interrogation_Position=687; Antisense; GGTCTATCTCATCATTTCGGCTAAG
>probe:Drosophila_2:1625124_at:609:497; Interrogation_Position=688; Antisense; GTCTATCTCATCATTTCGGCTAAGC
>probe:Drosophila_2:1625124_at:311:685; Interrogation_Position=691; Antisense; TATCTCATCATTTCGGCTAAGCCTG
>probe:Drosophila_2:1625124_at:204:645; Interrogation_Position=695; Antisense; TCATCATTTCGGCTAAGCCTGCGTA
>probe:Drosophila_2:1625124_at:296:647; Interrogation_Position=698; Antisense; TCATTTCGGCTAAGCCTGCGTATTT
>probe:Drosophila_2:1625124_at:686:715; Interrogation_Position=702; Antisense; TTCGGCTAAGCCTGCGTATTTGATA
>probe:Drosophila_2:1625124_at:52:573; Interrogation_Position=705; Antisense; GGCTAAGCCTGCGTATTTGATATTA
>probe:Drosophila_2:1625124_at:248:205; Interrogation_Position=709; Antisense; AAGCCTGCGTATTTGATATTATTAA
>probe:Drosophila_2:1625124_at:361:317; Interrogation_Position=711; Antisense; GCCTGCGTATTTGATATTATTAATT

Paste this into a BLAST search page for me
TGGTGCTGGCCTGGGTCTATCTCATTGCTGGCCTGGGTCTATCTCATCATTGGCCTGGGTCTATCTCATCATTTCGCCTGGGTCTATCTCATCATTTCGGTGGGTCTATCTCATCATTTCGGCTAGGTCTATCTCATCATTTCGGCTAAGGTCTATCTCATCATTTCGGCTAAGCTATCTCATCATTTCGGCTAAGCCTGTCATCATTTCGGCTAAGCCTGCGTATCATTTCGGCTAAGCCTGCGTATTTTTCGGCTAAGCCTGCGTATTTGATAGGCTAAGCCTGCGTATTTGATATTAAAGCCTGCGTATTTGATATTATTAAGCCTGCGTATTTGATATTATTAATT

Full Affymetrix probeset data:

Annotations for 1625124_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime