FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625126_at:

>probe:Drosophila_2:1625126_at:362:107; Interrogation_Position=3361; Antisense; AGAAGAGGCAGGAGCGTTCGTACAA
>probe:Drosophila_2:1625126_at:575:471; Interrogation_Position=3376; Antisense; GTTCGTACAAGCGAAGCTCGCCGGA
>probe:Drosophila_2:1625126_at:408:377; Interrogation_Position=3388; Antisense; GAAGCTCGCCGGAGGACGACAAGCT
>probe:Drosophila_2:1625126_at:543:409; Interrogation_Position=3402; Antisense; GACGACAAGCTGAGGCGCCAGAACA
>probe:Drosophila_2:1625126_at:87:225; Interrogation_Position=3426; Antisense; AAGGAACAGTCCGAATCCAAGCACG
>probe:Drosophila_2:1625126_at:698:185; Interrogation_Position=3465; Antisense; AACAATAGCGACGACTCGGATCGGA
>probe:Drosophila_2:1625126_at:61:523; Interrogation_Position=3490; Antisense; GGGCGGCCAAAAACACCAAGTCCAG
>probe:Drosophila_2:1625126_at:465:219; Interrogation_Position=3507; Antisense; AAGTCCAGCGACAGCCGAGTGGTCT
>probe:Drosophila_2:1625126_at:91:433; Interrogation_Position=3523; Antisense; GAGTGGTCTCCTCTGTAACAGCCGT
>probe:Drosophila_2:1625126_at:5:263; Interrogation_Position=3574; Antisense; CAGACAACCCGTTCCGCAAGTTCGT
>probe:Drosophila_2:1625126_at:520:215; Interrogation_Position=3591; Antisense; AAGTTCGTCGACACCAGTTCGTCGA
>probe:Drosophila_2:1625126_at:540:91; Interrogation_Position=3606; Antisense; AGTTCGTCGAGCAGCTTAGTTGTAA
>probe:Drosophila_2:1625126_at:204:329; Interrogation_Position=3660; Antisense; GCGTCCTCGGACAACGGCATGGAGC
>probe:Drosophila_2:1625126_at:115:243; Interrogation_Position=3724; Antisense; AATATTCGTCAACCGATTCGTTGAA

Paste this into a BLAST search page for me
AGAAGAGGCAGGAGCGTTCGTACAAGTTCGTACAAGCGAAGCTCGCCGGAGAAGCTCGCCGGAGGACGACAAGCTGACGACAAGCTGAGGCGCCAGAACAAAGGAACAGTCCGAATCCAAGCACGAACAATAGCGACGACTCGGATCGGAGGGCGGCCAAAAACACCAAGTCCAGAAGTCCAGCGACAGCCGAGTGGTCTGAGTGGTCTCCTCTGTAACAGCCGTCAGACAACCCGTTCCGCAAGTTCGTAAGTTCGTCGACACCAGTTCGTCGAAGTTCGTCGAGCAGCTTAGTTGTAAGCGTCCTCGGACAACGGCATGGAGCAATATTCGTCAACCGATTCGTTGAA

Full Affymetrix probeset data:

Annotations for 1625126_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720