FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625127_at:

>probe:Drosophila_2:1625127_at:251:223; Interrogation_Position=7204; Antisense; AAGGTCAGCGAAACCAATCACCCAA
>probe:Drosophila_2:1625127_at:227:583; Interrogation_Position=7284; Antisense; TGGCAAATTTCCTTCGGTTAGCAAA
>probe:Drosophila_2:1625127_at:658:537; Interrogation_Position=7299; Antisense; GGTTAGCAAATGATTCTTCGCAATT
>probe:Drosophila_2:1625127_at:226:181; Interrogation_Position=7329; Antisense; AAAAATCACTTACCATCTCGCTTAT
>probe:Drosophila_2:1625127_at:250:451; Interrogation_Position=7389; Antisense; GATCGTGGCGACAAAGATGTCCGCA
>probe:Drosophila_2:1625127_at:635:597; Interrogation_Position=7406; Antisense; TGTCCGCACATGTTTCCAAAGCTTA
>probe:Drosophila_2:1625127_at:378:7; Interrogation_Position=7449; Antisense; ATTGCCTAGGCAAGTTTAGTTCGTA
>probe:Drosophila_2:1625127_at:726:257; Interrogation_Position=7539; Antisense; CACACACCTATGCTTAGAGTTGTTA
>probe:Drosophila_2:1625127_at:584:233; Interrogation_Position=7652; Antisense; AATCCAACCGCAAGGGAACGTCTCA
>probe:Drosophila_2:1625127_at:179:383; Interrogation_Position=7667; Antisense; GAACGTCTCAGTCCAAATTGTCGGT
>probe:Drosophila_2:1625127_at:236:501; Interrogation_Position=7686; Antisense; GTCGGTACACGAATTCTTATTTTAT
>probe:Drosophila_2:1625127_at:650:661; Interrogation_Position=7736; Antisense; TAAAAATGTAGTCCGATCCCCATTC
>probe:Drosophila_2:1625127_at:506:7; Interrogation_Position=7757; Antisense; ATTCCCAAATCATCATCCTACGGAC
>probe:Drosophila_2:1625127_at:536:629; Interrogation_Position=7772; Antisense; TCCTACGGACCGCTATGAGCAAATT

Paste this into a BLAST search page for me
AAGGTCAGCGAAACCAATCACCCAATGGCAAATTTCCTTCGGTTAGCAAAGGTTAGCAAATGATTCTTCGCAATTAAAAATCACTTACCATCTCGCTTATGATCGTGGCGACAAAGATGTCCGCATGTCCGCACATGTTTCCAAAGCTTAATTGCCTAGGCAAGTTTAGTTCGTACACACACCTATGCTTAGAGTTGTTAAATCCAACCGCAAGGGAACGTCTCAGAACGTCTCAGTCCAAATTGTCGGTGTCGGTACACGAATTCTTATTTTATTAAAAATGTAGTCCGATCCCCATTCATTCCCAAATCATCATCCTACGGACTCCTACGGACCGCTATGAGCAAATT

Full Affymetrix probeset data:

Annotations for 1625127_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720