Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625128_a_at:

>probe:Drosophila_2:1625128_a_at:53:353; Interrogation_Position=101; Antisense; GCAGCAGTGTGATTGCACGCAACTT
>probe:Drosophila_2:1625128_a_at:727:259; Interrogation_Position=116; Antisense; CACGCAACTTTTCCCAGTCGATGGT
>probe:Drosophila_2:1625128_a_at:241:309; Interrogation_Position=129; Antisense; CCAGTCGATGGTTCGCTTTAGCGGA
>probe:Drosophila_2:1625128_a_at:145:273; Interrogation_Position=13; Antisense; CATTTGTCATCTCTATTCTGCGCAC
>probe:Drosophila_2:1625128_a_at:336:697; Interrogation_Position=145; Antisense; TTTAGCGGACATGGTGGAGTTCCCG
>probe:Drosophila_2:1625128_a_at:116:367; Interrogation_Position=160; Antisense; GGAGTTCCCGGAGAGAATCTTCCCT
>probe:Drosophila_2:1625128_a_at:681:107; Interrogation_Position=173; Antisense; AGAATCTTCCCTTCGGGCTGACGAA
>probe:Drosophila_2:1625128_a_at:56:525; Interrogation_Position=187; Antisense; GGGCTGACGAACAAGTACCGCATCA
>probe:Drosophila_2:1625128_a_at:449:41; Interrogation_Position=226; Antisense; ATCGGCTGTGTCTTGGGCTTCGGAT
>probe:Drosophila_2:1625128_a_at:378:497; Interrogation_Position=265; Antisense; GTCAGGCACCAACTGCTCAAGAAGT
>probe:Drosophila_2:1625128_a_at:263:121; Interrogation_Position=331; Antisense; AGCGTTATCTGCTGAGTTGGCCGGC
>probe:Drosophila_2:1625128_a_at:95:317; Interrogation_Position=350; Antisense; GCCGGCAGGCCATTACAGTGTGTTA
>probe:Drosophila_2:1625128_a_at:242:133; Interrogation_Position=36; Antisense; ACCCACTGCGAACTTTATTTTCCTG
>probe:Drosophila_2:1625128_a_at:543:247; Interrogation_Position=82; Antisense; AATTGCGAGATGTTGGGCCGCAGCA

Paste this into a BLAST search page for me
GCAGCAGTGTGATTGCACGCAACTTCACGCAACTTTTCCCAGTCGATGGTCCAGTCGATGGTTCGCTTTAGCGGACATTTGTCATCTCTATTCTGCGCACTTTAGCGGACATGGTGGAGTTCCCGGGAGTTCCCGGAGAGAATCTTCCCTAGAATCTTCCCTTCGGGCTGACGAAGGGCTGACGAACAAGTACCGCATCAATCGGCTGTGTCTTGGGCTTCGGATGTCAGGCACCAACTGCTCAAGAAGTAGCGTTATCTGCTGAGTTGGCCGGCGCCGGCAGGCCATTACAGTGTGTTAACCCACTGCGAACTTTATTTTCCTGAATTGCGAGATGTTGGGCCGCAGCA

Full Affymetrix probeset data:

Annotations for 1625128_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime