FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625129_at:

>probe:Drosophila_2:1625129_at:695:719; Interrogation_Position=119; Antisense; TTCCTGCGTGACATATTGCGCTGGT
>probe:Drosophila_2:1625129_at:718:225; Interrogation_Position=164; Antisense; AAGGAATCCCTGTCCTATTTACTCA
>probe:Drosophila_2:1625129_at:184:697; Interrogation_Position=229; Antisense; TTTCACATCCAATGCGGTGGCCGTA
>probe:Drosophila_2:1625129_at:337:579; Interrogation_Position=246; Antisense; TGGCCGTACTTGTTGGTGGCGCCAA
>probe:Drosophila_2:1625129_at:195:379; Interrogation_Position=272; Antisense; GAAGCCATGGATTCGCATCCGGGAC
>probe:Drosophila_2:1625129_at:223:559; Interrogation_Position=293; Antisense; GGACAGTACATTTTGACCCTCAAGG
>probe:Drosophila_2:1625129_at:556:167; Interrogation_Position=336; Antisense; AAATGGCTGTTCGAACCGGATCGTC
>probe:Drosophila_2:1625129_at:222:711; Interrogation_Position=399; Antisense; TTGATCAGGTGGCTAATCCTCCGGA
>probe:Drosophila_2:1625129_at:302:631; Interrogation_Position=432; Antisense; TCCGTCGCTTCCAGAATGTGGTCAA
>probe:Drosophila_2:1625129_at:119:395; Interrogation_Position=457; Antisense; GAAATTCACAGGCATTTCACCGCTC
>probe:Drosophila_2:1625129_at:182:81; Interrogation_Position=489; Antisense; AGGGTCGCGGTATCTTCAACTACAA
>probe:Drosophila_2:1625129_at:593:649; Interrogation_Position=504; Antisense; TCAACTACAACTATGGCATTCTCCC
>probe:Drosophila_2:1625129_at:114:425; Interrogation_Position=584; Antisense; GAGACTCCCGATCCCGAATATGTGG
>probe:Drosophila_2:1625129_at:13:49; Interrogation_Position=614; Antisense; ATCCATGGGCAGGTGATCGACGCGC

Paste this into a BLAST search page for me
TTCCTGCGTGACATATTGCGCTGGTAAGGAATCCCTGTCCTATTTACTCATTTCACATCCAATGCGGTGGCCGTATGGCCGTACTTGTTGGTGGCGCCAAGAAGCCATGGATTCGCATCCGGGACGGACAGTACATTTTGACCCTCAAGGAAATGGCTGTTCGAACCGGATCGTCTTGATCAGGTGGCTAATCCTCCGGATCCGTCGCTTCCAGAATGTGGTCAAGAAATTCACAGGCATTTCACCGCTCAGGGTCGCGGTATCTTCAACTACAATCAACTACAACTATGGCATTCTCCCGAGACTCCCGATCCCGAATATGTGGATCCATGGGCAGGTGATCGACGCGC

Full Affymetrix probeset data:

Annotations for 1625129_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720