FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625130_at:

>probe:Drosophila_2:1625130_at:164:225; Interrogation_Position=3078; Antisense; AAGGACTCGTGCCAAGGCGACTCTG
>probe:Drosophila_2:1625130_at:433:641; Interrogation_Position=3099; Antisense; TCTGGAGGACCTTTGATGCACGACA
>probe:Drosophila_2:1625130_at:3:253; Interrogation_Position=3122; Antisense; CAAGAATGGGCGCTGGTACCTGATT
>probe:Drosophila_2:1625130_at:599:3; Interrogation_Position=3144; Antisense; ATTGGTGTGGTCTCTGCTGGTTACT
>probe:Drosophila_2:1625130_at:249:291; Interrogation_Position=3190; Antisense; CGGGAATCTATCACAGCGTCAGCAA
>probe:Drosophila_2:1625130_at:580:209; Interrogation_Position=3213; Antisense; AAGACCGTGGACTGGGTATCCTACG
>probe:Drosophila_2:1625130_at:233:245; Interrogation_Position=3262; Antisense; AATTTATTCTCATCGCAATCGCAAT
>probe:Drosophila_2:1625130_at:138:237; Interrogation_Position=3278; Antisense; AATCGCAATCGTATCGCATCCGCAT
>probe:Drosophila_2:1625130_at:691:19; Interrogation_Position=3307; Antisense; ATTTGCACCTGCCTGCTAAGTGGGC
>probe:Drosophila_2:1625130_at:712:517; Interrogation_Position=3326; Antisense; GTGGGCCACAGATTGTTTTGTACAT
>probe:Drosophila_2:1625130_at:36:491; Interrogation_Position=3345; Antisense; GTACATAACTCACTTCATTCTGCTC
>probe:Drosophila_2:1625130_at:703:259; Interrogation_Position=3388; Antisense; CACGCCGCCTAATTTATGGTTACAC
>probe:Drosophila_2:1625130_at:169:159; Interrogation_Position=3497; Antisense; ACACACGTGTGCGATATCTGTATCT
>probe:Drosophila_2:1625130_at:75:643; Interrogation_Position=3529; Antisense; TCTGCAAGCACCCTAAGCCTTAAAT

Paste this into a BLAST search page for me
AAGGACTCGTGCCAAGGCGACTCTGTCTGGAGGACCTTTGATGCACGACACAAGAATGGGCGCTGGTACCTGATTATTGGTGTGGTCTCTGCTGGTTACTCGGGAATCTATCACAGCGTCAGCAAAAGACCGTGGACTGGGTATCCTACGAATTTATTCTCATCGCAATCGCAATAATCGCAATCGTATCGCATCCGCATATTTGCACCTGCCTGCTAAGTGGGCGTGGGCCACAGATTGTTTTGTACATGTACATAACTCACTTCATTCTGCTCCACGCCGCCTAATTTATGGTTACACACACACGTGTGCGATATCTGTATCTTCTGCAAGCACCCTAAGCCTTAAAT

Full Affymetrix probeset data:

Annotations for 1625130_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720