FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625133_at:

>probe:Drosophila_2:1625133_at:26:157; Interrogation_Position=1697; Antisense; AAATCCCCAATTTCGAGGCCTTGTG
>probe:Drosophila_2:1625133_at:374:533; Interrogation_Position=1737; Antisense; GGTGGTGCCATCAGAGCGTCAAGCT
>probe:Drosophila_2:1625133_at:311:165; Interrogation_Position=1786; Antisense; AAATCAGCCAGATCCCTCAATGTTC
>probe:Drosophila_2:1625133_at:488:249; Interrogation_Position=1803; Antisense; CAATGTTCGTGGTAGTACTTCTCCC
>probe:Drosophila_2:1625133_at:570:305; Interrogation_Position=1827; Antisense; CCTTGCGTGCTATCAACCTGAAGAG
>probe:Drosophila_2:1625133_at:279:337; Interrogation_Position=1859; Antisense; GCTCCAGTTCCAGTGATACCGATGG
>probe:Drosophila_2:1625133_at:141:381; Interrogation_Position=1909; Antisense; GAACCTGCCAAACGTGATCCGAAAT
>probe:Drosophila_2:1625133_at:72:443; Interrogation_Position=1924; Antisense; GATCCGAAATCGCTCAAAGTCCGCT
>probe:Drosophila_2:1625133_at:570:31; Interrogation_Position=1958; Antisense; ATAATCTGCAGTACTACCAGTCCGC
>probe:Drosophila_2:1625133_at:318:547; Interrogation_Position=2016; Antisense; GGATGAGCCGATGCAACAGCCAACT
>probe:Drosophila_2:1625133_at:652:309; Interrogation_Position=2042; Antisense; CCACGCAGCGTTCGATCATTTTTGA
>probe:Drosophila_2:1625133_at:268:493; Interrogation_Position=2072; Antisense; GTAATACTGGAGTGCCCAGCCTATT
>probe:Drosophila_2:1625133_at:11:557; Interrogation_Position=2143; Antisense; GGACGAGCTATCAGCCAACATCGCT
>probe:Drosophila_2:1625133_at:719:307; Interrogation_Position=2168; Antisense; CCATGACTGCGACACTTAGGACAAA

Paste this into a BLAST search page for me
AAATCCCCAATTTCGAGGCCTTGTGGGTGGTGCCATCAGAGCGTCAAGCTAAATCAGCCAGATCCCTCAATGTTCCAATGTTCGTGGTAGTACTTCTCCCCCTTGCGTGCTATCAACCTGAAGAGGCTCCAGTTCCAGTGATACCGATGGGAACCTGCCAAACGTGATCCGAAATGATCCGAAATCGCTCAAAGTCCGCTATAATCTGCAGTACTACCAGTCCGCGGATGAGCCGATGCAACAGCCAACTCCACGCAGCGTTCGATCATTTTTGAGTAATACTGGAGTGCCCAGCCTATTGGACGAGCTATCAGCCAACATCGCTCCATGACTGCGACACTTAGGACAAA

Full Affymetrix probeset data:

Annotations for 1625133_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720