Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625134_at:

>probe:Drosophila_2:1625134_at:573:231; Interrogation_Position=1032; Antisense; AATGATAGCCGAGACTGCGACGACT
>probe:Drosophila_2:1625134_at:582:67; Interrogation_Position=1090; Antisense; ATGGCGATTACCGTCTGGCTATTAC
>probe:Drosophila_2:1625134_at:313:287; Interrogation_Position=1104; Antisense; CTGGCTATTACGTGCCCCAATAAGG
>probe:Drosophila_2:1625134_at:54:625; Interrogation_Position=1183; Antisense; TGCGCAATCCCAACCAAGAGAATCT
>probe:Drosophila_2:1625134_at:676:213; Interrogation_Position=1198; Antisense; AAGAGAATCTACGTCGCCATGCCAA
>probe:Drosophila_2:1625134_at:608:211; Interrogation_Position=1239; Antisense; AAGAAACGTGCCTACGAGCTGCCAT
>probe:Drosophila_2:1625134_at:344:419; Interrogation_Position=1254; Antisense; GAGCTGCCATGACTTCTGATCTGGT
>probe:Drosophila_2:1625134_at:106:537; Interrogation_Position=1276; Antisense; GGTCGACAATCTCCCAGGTATCAGA
>probe:Drosophila_2:1625134_at:271:477; Interrogation_Position=1357; Antisense; GTTTGTATTAGTCCTTGTTCGTAAG
>probe:Drosophila_2:1625134_at:98:661; Interrogation_Position=1387; Antisense; TAACGGTGATATTCCCCTTTTGGCA
>probe:Drosophila_2:1625134_at:231:307; Interrogation_Position=1402; Antisense; CCTTTTGGCATGTTCGATGGCCGAA
>probe:Drosophila_2:1625134_at:440:195; Interrogation_Position=1466; Antisense; AACTGCAGTTCTATGTGACTACGTA
>probe:Drosophila_2:1625134_at:669:397; Interrogation_Position=1482; Antisense; GACTACGTAACTTTTGTCTACCACA
>probe:Drosophila_2:1625134_at:393:251; Interrogation_Position=986; Antisense; CAAGGTGCGTCGGTGCATTGCTATA

Paste this into a BLAST search page for me
AATGATAGCCGAGACTGCGACGACTATGGCGATTACCGTCTGGCTATTACCTGGCTATTACGTGCCCCAATAAGGTGCGCAATCCCAACCAAGAGAATCTAAGAGAATCTACGTCGCCATGCCAAAAGAAACGTGCCTACGAGCTGCCATGAGCTGCCATGACTTCTGATCTGGTGGTCGACAATCTCCCAGGTATCAGAGTTTGTATTAGTCCTTGTTCGTAAGTAACGGTGATATTCCCCTTTTGGCACCTTTTGGCATGTTCGATGGCCGAAAACTGCAGTTCTATGTGACTACGTAGACTACGTAACTTTTGTCTACCACACAAGGTGCGTCGGTGCATTGCTATA

Full Affymetrix probeset data:

Annotations for 1625134_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime