FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625135_at:

>probe:Drosophila_2:1625135_at:530:443; Interrogation_Position=106; Antisense; GATGACTTCCGCCAGATTTCCCTAA
>probe:Drosophila_2:1625135_at:105:13; Interrogation_Position=121; Antisense; ATTTCCCTAACGCTGGGCAACAAGG
>probe:Drosophila_2:1625135_at:169:419; Interrogation_Position=145; Antisense; GAGCTGCGTTTTGCGGACGGCATCT
>probe:Drosophila_2:1625135_at:237:345; Interrogation_Position=164; Antisense; GCATCTGGATGCATTCGACCCGAAA
>probe:Drosophila_2:1625135_at:192:343; Interrogation_Position=174; Antisense; GCATTCGACCCGAAAGGGTGACGTA
>probe:Drosophila_2:1625135_at:107:511; Interrogation_Position=191; Antisense; GTGACGTAGATGATATGCTCCGGCT
>probe:Drosophila_2:1625135_at:468:99; Interrogation_Position=198; Antisense; AGATGATATGCTCCGGCTGAACAAG
>probe:Drosophila_2:1625135_at:278:159; Interrogation_Position=218; Antisense; ACAAGAAGTTTCGTGCCCTCGAGGA
>probe:Drosophila_2:1625135_at:428:97; Interrogation_Position=266; Antisense; AGATCGAGGTGATGCTGGATCTGCT
>probe:Drosophila_2:1625135_at:712:91; Interrogation_Position=32; Antisense; AGTTCGAGTCGAAGCCGATTCCAGT
>probe:Drosophila_2:1625135_at:170:347; Interrogation_Position=42; Antisense; GAAGCCGATTCCAGTGCGTCAGGGA
>probe:Drosophila_2:1625135_at:222:327; Interrogation_Position=57; Antisense; GCGTCAGGGACGTTGCAATATAGGA
>probe:Drosophila_2:1625135_at:136:243; Interrogation_Position=73; Antisense; AATATAGGACATCCGGTGGCCACCG
>probe:Drosophila_2:1625135_at:644:77; Interrogation_Position=98; Antisense; AGGATCTGGATGACTTCCGCCAGAT

Paste this into a BLAST search page for me
GATGACTTCCGCCAGATTTCCCTAAATTTCCCTAACGCTGGGCAACAAGGGAGCTGCGTTTTGCGGACGGCATCTGCATCTGGATGCATTCGACCCGAAAGCATTCGACCCGAAAGGGTGACGTAGTGACGTAGATGATATGCTCCGGCTAGATGATATGCTCCGGCTGAACAAGACAAGAAGTTTCGTGCCCTCGAGGAAGATCGAGGTGATGCTGGATCTGCTAGTTCGAGTCGAAGCCGATTCCAGTGAAGCCGATTCCAGTGCGTCAGGGAGCGTCAGGGACGTTGCAATATAGGAAATATAGGACATCCGGTGGCCACCGAGGATCTGGATGACTTCCGCCAGAT

Full Affymetrix probeset data:

Annotations for 1625135_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720