Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625136_s_at:

>probe:Drosophila_2:1625136_s_at:580:163; Interrogation_Position=201; Antisense; AAATAATGCGGCTGCCACCGAAGGC
>probe:Drosophila_2:1625136_s_at:333:543; Interrogation_Position=234; Antisense; GGATAACGCTAGTGGTTCCGCACCA
>probe:Drosophila_2:1625136_s_at:88:237; Interrogation_Position=282; Antisense; AATCCCAGTGGAGACCTCGATTCGA
>probe:Drosophila_2:1625136_s_at:381:307; Interrogation_Position=335; Antisense; CCTACGGCGAGGACTTTGTGTGGAC
>probe:Drosophila_2:1625136_s_at:275:685; Interrogation_Position=364; Antisense; TATCGGCGCAACCACAAGGGCATGT
>probe:Drosophila_2:1625136_s_at:437:221; Interrogation_Position=379; Antisense; AAGGGCATGTATGCGCCGCGCAAAA
>probe:Drosophila_2:1625136_s_at:223:137; Interrogation_Position=405; Antisense; ACGAAAGACGTGCATCCGCCAGAAC
>probe:Drosophila_2:1625136_s_at:408:501; Interrogation_Position=452; Antisense; GTCCCATTTGCCGTGATGAATACCT
>probe:Drosophila_2:1625136_s_at:720:361; Interrogation_Position=469; Antisense; GAATACCTGGTGCTGGACTACCGCA
>probe:Drosophila_2:1625136_s_at:539:121; Interrogation_Position=529; Antisense; AGCGGAGACGTCCTTAGCTACTCAA
>probe:Drosophila_2:1625136_s_at:481:675; Interrogation_Position=543; Antisense; TAGCTACTCAAAGACAGGCCTGTGT
>probe:Drosophila_2:1625136_s_at:588:183; Interrogation_Position=569; Antisense; AAAAGAGCCACCTGCGTCTAATGGT
>probe:Drosophila_2:1625136_s_at:72:403; Interrogation_Position=613; Antisense; GACTCCGGGTACCTAACATACGATG
>probe:Drosophila_2:1625136_s_at:285:191; Interrogation_Position=627; Antisense; AACATACGATGTGCCCTTCAGGGAG

Paste this into a BLAST search page for me
AAATAATGCGGCTGCCACCGAAGGCGGATAACGCTAGTGGTTCCGCACCAAATCCCAGTGGAGACCTCGATTCGACCTACGGCGAGGACTTTGTGTGGACTATCGGCGCAACCACAAGGGCATGTAAGGGCATGTATGCGCCGCGCAAAAACGAAAGACGTGCATCCGCCAGAACGTCCCATTTGCCGTGATGAATACCTGAATACCTGGTGCTGGACTACCGCAAGCGGAGACGTCCTTAGCTACTCAATAGCTACTCAAAGACAGGCCTGTGTAAAAGAGCCACCTGCGTCTAATGGTGACTCCGGGTACCTAACATACGATGAACATACGATGTGCCCTTCAGGGAG

Full Affymetrix probeset data:

Annotations for 1625136_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime