Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625137_at:

>probe:Drosophila_2:1625137_at:720:325; Interrogation_Position=1303; Antisense; GCGAGCGACCATATCAGTGTGGAGT
>probe:Drosophila_2:1625137_at:562:295; Interrogation_Position=1334; Antisense; CGAGAGCTTTGTGTGCGGTTCGCAC
>probe:Drosophila_2:1625137_at:701:469; Interrogation_Position=1351; Antisense; GTTCGCACCTGAATATCCATCGTAA
>probe:Drosophila_2:1625137_at:128:151; Interrogation_Position=1385; Antisense; ACATCTGATTGCTGTGATTCCGGGC
>probe:Drosophila_2:1625137_at:570:71; Interrogation_Position=1420; Antisense; AGGCAAATTTTGCTGCTGATCCTTA
>probe:Drosophila_2:1625137_at:197:663; Interrogation_Position=1447; Antisense; TAAATGCTAGGGTCAACCAGCGCCG
>probe:Drosophila_2:1625137_at:105:253; Interrogation_Position=1460; Antisense; CAACCAGCGCCGTTCGGAGGATATA
>probe:Drosophila_2:1625137_at:519:21; Interrogation_Position=1480; Antisense; ATATAGAGCGTATGCGCCTGCAACG
>probe:Drosophila_2:1625137_at:726:297; Interrogation_Position=1503; Antisense; CGCATTCCCGAAAACCAATTGCAAC
>probe:Drosophila_2:1625137_at:696:423; Interrogation_Position=1529; Antisense; GAGACTGGAAAATCTCCCCAAACCG
>probe:Drosophila_2:1625137_at:529:547; Interrogation_Position=1553; Antisense; GGATGTCCCGGCTATGTGCTACAAA
>probe:Drosophila_2:1625137_at:684:339; Interrogation_Position=1570; Antisense; GCTACAAATGCGGTGTCTGCGAACA
>probe:Drosophila_2:1625137_at:670:645; Interrogation_Position=1600; Antisense; TCAAAAGTGGAGCTCTCCTGACCGT
>probe:Drosophila_2:1625137_at:602:627; Interrogation_Position=1615; Antisense; TCCTGACCGTCCATCGCAATAAAAT

Paste this into a BLAST search page for me
GCGAGCGACCATATCAGTGTGGAGTCGAGAGCTTTGTGTGCGGTTCGCACGTTCGCACCTGAATATCCATCGTAAACATCTGATTGCTGTGATTCCGGGCAGGCAAATTTTGCTGCTGATCCTTATAAATGCTAGGGTCAACCAGCGCCGCAACCAGCGCCGTTCGGAGGATATAATATAGAGCGTATGCGCCTGCAACGCGCATTCCCGAAAACCAATTGCAACGAGACTGGAAAATCTCCCCAAACCGGGATGTCCCGGCTATGTGCTACAAAGCTACAAATGCGGTGTCTGCGAACATCAAAAGTGGAGCTCTCCTGACCGTTCCTGACCGTCCATCGCAATAAAAT

Full Affymetrix probeset data:

Annotations for 1625137_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime