FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625138_at:

>probe:Drosophila_2:1625138_at:321:127; Interrogation_Position=108; Antisense; AGCCAAAAGGCTGGTGCTCTCGCTA
>probe:Drosophila_2:1625138_at:434:337; Interrogation_Position=123; Antisense; GCTCTCGCTACGTGGACGCAAGAAT
>probe:Drosophila_2:1625138_at:211:359; Interrogation_Position=140; Antisense; GCAAGAATTCGCAGGGCAACTCGGC
>probe:Drosophila_2:1625138_at:344:635; Interrogation_Position=199; Antisense; TCGCCCGGCCATGAGCTGGATGAAA
>probe:Drosophila_2:1625138_at:194:27; Interrogation_Position=223; Antisense; ATAGCCGTGGTCTCGGGCACAGGAT
>probe:Drosophila_2:1625138_at:635:565; Interrogation_Position=238; Antisense; GGCACAGGATCCAGCAGTCACCATT
>probe:Drosophila_2:1625138_at:286:89; Interrogation_Position=253; Antisense; AGTCACCATTTCTCCTATGGCGGCT
>probe:Drosophila_2:1625138_at:655:625; Interrogation_Position=302; Antisense; TGCCGCGCTACTCAACAGGTGAGTG
>probe:Drosophila_2:1625138_at:71:139; Interrogation_Position=356; Antisense; ACGTGTACAACTTTGGCCTCCAAAT
>probe:Drosophila_2:1625138_at:285:421; Interrogation_Position=383; Antisense; GAGAATCTAGCACCCGAAAGTCACC
>probe:Drosophila_2:1625138_at:638:393; Interrogation_Position=398; Antisense; GAAAGTCACCAAATGATCTGCGAAA
>probe:Drosophila_2:1625138_at:414:387; Interrogation_Position=419; Antisense; GAAAATACTTCGTCTTCGAGATCTA
>probe:Drosophila_2:1625138_at:150:573; Interrogation_Position=73; Antisense; GGCGGCCAAGCGACGACAATCGTTG
>probe:Drosophila_2:1625138_at:675:395; Interrogation_Position=87; Antisense; GACAATCGTTGGCATGTCCACAGCC

Paste this into a BLAST search page for me
AGCCAAAAGGCTGGTGCTCTCGCTAGCTCTCGCTACGTGGACGCAAGAATGCAAGAATTCGCAGGGCAACTCGGCTCGCCCGGCCATGAGCTGGATGAAAATAGCCGTGGTCTCGGGCACAGGATGGCACAGGATCCAGCAGTCACCATTAGTCACCATTTCTCCTATGGCGGCTTGCCGCGCTACTCAACAGGTGAGTGACGTGTACAACTTTGGCCTCCAAATGAGAATCTAGCACCCGAAAGTCACCGAAAGTCACCAAATGATCTGCGAAAGAAAATACTTCGTCTTCGAGATCTAGGCGGCCAAGCGACGACAATCGTTGGACAATCGTTGGCATGTCCACAGCC

Full Affymetrix probeset data:

Annotations for 1625138_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720