FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625139_at:

>probe:Drosophila_2:1625139_at:693:187; Interrogation_Position=259; Antisense; AACACCCACAATATGGTCGTCGAGG
>probe:Drosophila_2:1625139_at:413:499; Interrogation_Position=277; Antisense; GTCGAGGAGAACTGCAGCATGCACC
>probe:Drosophila_2:1625139_at:404:637; Interrogation_Position=335; Antisense; TCGATATGGCCATGGAGTGTGCCCC
>probe:Drosophila_2:1625139_at:348:505; Interrogation_Position=442; Antisense; GTGCTCTCCAAGTCGCCGGAGGGAT
>probe:Drosophila_2:1625139_at:226:435; Interrogation_Position=460; Antisense; GAGGGATCCCTCTTCTGCCTGATGG
>probe:Drosophila_2:1625139_at:177:351; Interrogation_Position=519; Antisense; GCACGAGGTACTGCTGGAGGCCTTT
>probe:Drosophila_2:1625139_at:498:523; Interrogation_Position=534; Antisense; GGAGGCCTTTTGCTACGAGAACGAC
>probe:Drosophila_2:1625139_at:160:199; Interrogation_Position=553; Antisense; AACGACATCTACGTGATCAAGGTGG
>probe:Drosophila_2:1625139_at:398:637; Interrogation_Position=620; Antisense; TCGAGTCGTGCTGCCTGGTCCAGAA
>probe:Drosophila_2:1625139_at:694:603; Interrogation_Position=674; Antisense; TGACCAAGGCCGAGAACCAGCTAGT
>probe:Drosophila_2:1625139_at:670:379; Interrogation_Position=687; Antisense; GAACCAGCTAGTCGACTACTGCGAG
>probe:Drosophila_2:1625139_at:138:513; Interrogation_Position=769; Antisense; GTGAGCGGGACAGCCAGATGTCACA
>probe:Drosophila_2:1625139_at:427:495; Interrogation_Position=788; Antisense; GTCACAGAATTGAATGGCCCCGCAC
>probe:Drosophila_2:1625139_at:79:357; Interrogation_Position=809; Antisense; GCACAGTGGGCGCAAGCAAACTCTA

Paste this into a BLAST search page for me
AACACCCACAATATGGTCGTCGAGGGTCGAGGAGAACTGCAGCATGCACCTCGATATGGCCATGGAGTGTGCCCCGTGCTCTCCAAGTCGCCGGAGGGATGAGGGATCCCTCTTCTGCCTGATGGGCACGAGGTACTGCTGGAGGCCTTTGGAGGCCTTTTGCTACGAGAACGACAACGACATCTACGTGATCAAGGTGGTCGAGTCGTGCTGCCTGGTCCAGAATGACCAAGGCCGAGAACCAGCTAGTGAACCAGCTAGTCGACTACTGCGAGGTGAGCGGGACAGCCAGATGTCACAGTCACAGAATTGAATGGCCCCGCACGCACAGTGGGCGCAAGCAAACTCTA

Full Affymetrix probeset data:

Annotations for 1625139_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720