Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625140_at:

>probe:Drosophila_2:1625140_at:233:521; Interrogation_Position=1317; Antisense; GTGGCAATTGAGTTCACGCTGCAAA
>probe:Drosophila_2:1625140_at:554:237; Interrogation_Position=1344; Antisense; AATCGGAGCTTCTACATGACCGTCT
>probe:Drosophila_2:1625140_at:452:55; Interrogation_Position=1359; Antisense; ATGACCGTCTTCTATTTGCCGTTGA
>probe:Drosophila_2:1625140_at:459:725; Interrogation_Position=1380; Antisense; TTGATTGCCTGCCAGATGTTCCTGA
>probe:Drosophila_2:1625140_at:709:59; Interrogation_Position=1395; Antisense; ATGTTCCTGATTTTGTCCTTTGTAC
>probe:Drosophila_2:1625140_at:12:725; Interrogation_Position=1414; Antisense; TTGTACTGCGTTCTACTCGTAGGAG
>probe:Drosophila_2:1625140_at:103:711; Interrogation_Position=1479; Antisense; TTAATGTACATGACGCGCTACGCCT
>probe:Drosophila_2:1625140_at:399:507; Interrogation_Position=1515; Antisense; GTGCCGCCCATGATGACTGCATATA
>probe:Drosophila_2:1625140_at:342:607; Interrogation_Position=1549; Antisense; TGATGACCACCACCTATTGCTACAT
>probe:Drosophila_2:1625140_at:698:641; Interrogation_Position=1601; Antisense; TCTATATCCACCCAGATCGAAGGCT
>probe:Drosophila_2:1625140_at:280:709; Interrogation_Position=1648; Antisense; TTAACTCCAATGTTCTGCGATGCAT
>probe:Drosophila_2:1625140_at:417:543; Interrogation_Position=1691; Antisense; GGATTCTACCGACTATTGCGACATT
>probe:Drosophila_2:1625140_at:236:579; Interrogation_Position=1739; Antisense; GGCCAAGATCCTGAACAACCTGAGT
>probe:Drosophila_2:1625140_at:429:497; Interrogation_Position=1773; Antisense; GTCATTATAACCTTTGCCATCGTAG

Paste this into a BLAST search page for me
GTGGCAATTGAGTTCACGCTGCAAAAATCGGAGCTTCTACATGACCGTCTATGACCGTCTTCTATTTGCCGTTGATTGATTGCCTGCCAGATGTTCCTGAATGTTCCTGATTTTGTCCTTTGTACTTGTACTGCGTTCTACTCGTAGGAGTTAATGTACATGACGCGCTACGCCTGTGCCGCCCATGATGACTGCATATATGATGACCACCACCTATTGCTACATTCTATATCCACCCAGATCGAAGGCTTTAACTCCAATGTTCTGCGATGCATGGATTCTACCGACTATTGCGACATTGGCCAAGATCCTGAACAACCTGAGTGTCATTATAACCTTTGCCATCGTAG

Full Affymetrix probeset data:

Annotations for 1625140_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime