FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625141_at:

>probe:Drosophila_2:1625141_at:627:587; Interrogation_Position=167; Antisense; TGGAGAACTGCACCCGGAAGGCCAA
>probe:Drosophila_2:1625141_at:227:251; Interrogation_Position=189; Antisense; CAAGGGCGGCGATCTCGTCCACGTG
>probe:Drosophila_2:1625141_at:476:635; Interrogation_Position=203; Antisense; TCGTCCACGTGCACTACAGAGGAGC
>probe:Drosophila_2:1625141_at:418:585; Interrogation_Position=237; Antisense; TGGAACAGAGTTCGATAGCAGCTAC
>probe:Drosophila_2:1625141_at:330:699; Interrogation_Position=283; Antisense; TTTACCCTGGGAGCTCGGCAGGTGA
>probe:Drosophila_2:1625141_at:413:349; Interrogation_Position=351; Antisense; GCAGCGAAAGCTGACGATTCCGCCT
>probe:Drosophila_2:1625141_at:558:407; Interrogation_Position=363; Antisense; GACGATTCCGCCTGAGCTGGGATAC
>probe:Drosophila_2:1625141_at:424:51; Interrogation_Position=425; Antisense; ATGCGGTGCTCGTCTTCGATACGGA
>probe:Drosophila_2:1625141_at:15:493; Interrogation_Position=454; Antisense; GTAAAAATCGAACCGCGCTCTGGAT
>probe:Drosophila_2:1625141_at:271:523; Interrogation_Position=501; Antisense; GGGCCACAAATAGGCATTCCATGCT
>probe:Drosophila_2:1625141_at:335:9; Interrogation_Position=516; Antisense; ATTCCATGCTACACCCAAAGTTTAC
>probe:Drosophila_2:1625141_at:105:603; Interrogation_Position=597; Antisense; TGTTTCTGAAGTGATGCCACGCCAC
>probe:Drosophila_2:1625141_at:220:313; Interrogation_Position=612; Antisense; GCCACGCCACGACCAATAAATAATA
>probe:Drosophila_2:1625141_at:496:15; Interrogation_Position=91; Antisense; ATTTTGTTAATCTGCGCTTTTGTGG

Paste this into a BLAST search page for me
TGGAGAACTGCACCCGGAAGGCCAACAAGGGCGGCGATCTCGTCCACGTGTCGTCCACGTGCACTACAGAGGAGCTGGAACAGAGTTCGATAGCAGCTACTTTACCCTGGGAGCTCGGCAGGTGAGCAGCGAAAGCTGACGATTCCGCCTGACGATTCCGCCTGAGCTGGGATACATGCGGTGCTCGTCTTCGATACGGAGTAAAAATCGAACCGCGCTCTGGATGGGCCACAAATAGGCATTCCATGCTATTCCATGCTACACCCAAAGTTTACTGTTTCTGAAGTGATGCCACGCCACGCCACGCCACGACCAATAAATAATAATTTTGTTAATCTGCGCTTTTGTGG

Full Affymetrix probeset data:

Annotations for 1625141_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720