Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625142_s_at:

>probe:Drosophila_2:1625142_s_at:314:447; Interrogation_Position=222; Antisense; GATCCACTACAAGCGCAAGGTGCAC
>probe:Drosophila_2:1625142_s_at:561:203; Interrogation_Position=232; Antisense; AAGCGCAAGGTGCACCGCCCCAAGA
>probe:Drosophila_2:1625142_s_at:634:323; Interrogation_Position=234; Antisense; GCGCAAGGTGCACCGCCCCAAGAAG
>probe:Drosophila_2:1625142_s_at:429:251; Interrogation_Position=237; Antisense; CAAGGTGCACCGCCCCAAGAAGGTC
>probe:Drosophila_2:1625142_s_at:531:109; Interrogation_Position=254; Antisense; AGAAGGTCAAGACGATCCGCAGGAA
>probe:Drosophila_2:1625142_s_at:532:223; Interrogation_Position=256; Antisense; AAGGTCAAGACGATCCGCAGGAAGA
>probe:Drosophila_2:1625142_s_at:623:79; Interrogation_Position=257; Antisense; AGGTCAAGACGATCCGCAGGAAGAA
>probe:Drosophila_2:1625142_s_at:46:503; Interrogation_Position=49; Antisense; GTCGCCTGTTTCCTGGTGAGCCTGT
>probe:Drosophila_2:1625142_s_at:350:317; Interrogation_Position=52; Antisense; GCCTGTTTCCTGGTGAGCCTGTCCA
>probe:Drosophila_2:1625142_s_at:569:285; Interrogation_Position=54; Antisense; CTGTTTCCTGGTGAGCCTGTCCAGT
>probe:Drosophila_2:1625142_s_at:334:479; Interrogation_Position=56; Antisense; GTTTCCTGGTGAGCCTGTCCAGTGG
>probe:Drosophila_2:1625142_s_at:226:309; Interrogation_Position=74; Antisense; CCAGTGGCAGTACCACGACCACAAG
>probe:Drosophila_2:1625142_s_at:640:265; Interrogation_Position=75; Antisense; CAGTGGCAGTACCACGACCACAAGC
>probe:Drosophila_2:1625142_s_at:267:137; Interrogation_Position=88; Antisense; ACGACCACAAGCACAGATGCCACCA

Paste this into a BLAST search page for me
GATCCACTACAAGCGCAAGGTGCACAAGCGCAAGGTGCACCGCCCCAAGAGCGCAAGGTGCACCGCCCCAAGAAGCAAGGTGCACCGCCCCAAGAAGGTCAGAAGGTCAAGACGATCCGCAGGAAAAGGTCAAGACGATCCGCAGGAAGAAGGTCAAGACGATCCGCAGGAAGAAGTCGCCTGTTTCCTGGTGAGCCTGTGCCTGTTTCCTGGTGAGCCTGTCCACTGTTTCCTGGTGAGCCTGTCCAGTGTTTCCTGGTGAGCCTGTCCAGTGGCCAGTGGCAGTACCACGACCACAAGCAGTGGCAGTACCACGACCACAAGCACGACCACAAGCACAGATGCCACCA

Full Affymetrix probeset data:

Annotations for 1625142_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime