FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625143_at:

>probe:Drosophila_2:1625143_at:590:201; Interrogation_Position=100; Antisense; AACCAGGATACGGACGGCACCTACG
>probe:Drosophila_2:1625143_at:570:257; Interrogation_Position=117; Antisense; CACCTACGCCTATGATATCGAGCAG
>probe:Drosophila_2:1625143_at:1:61; Interrogation_Position=13; Antisense; ATGTACAAGCTCCTTCTCGTCGTCG
>probe:Drosophila_2:1625143_at:109:637; Interrogation_Position=134; Antisense; TCGAGCAGGCCAGCGGTATCCAGAT
>probe:Drosophila_2:1625143_at:471:377; Interrogation_Position=184; Antisense; GAAGCTCACGGATCGTACTCCTACA
>probe:Drosophila_2:1625143_at:10:363; Interrogation_Position=199; Antisense; TACTCCTACATCTCTCCCGAGGGTA
>probe:Drosophila_2:1625143_at:288:539; Interrogation_Position=220; Antisense; GGTATTCCCGTCCAGGTGGTGTACA
>probe:Drosophila_2:1625143_at:5:631; Interrogation_Position=230; Antisense; TCCAGGTGGTGTACACCGCCGATGA
>probe:Drosophila_2:1625143_at:170:445; Interrogation_Position=250; Antisense; GATGAGTTCGGCTTCCACCCACAGT
>probe:Drosophila_2:1625143_at:671:127; Interrogation_Position=294; Antisense; ACCACCAATCCCAGAGGAGATCCTG
>probe:Drosophila_2:1625143_at:374:121; Interrogation_Position=359; Antisense; AGCTGGCCGATCGTGCTGTTCGCGC
>probe:Drosophila_2:1625143_at:622:581; Interrogation_Position=56; Antisense; TGGCCGCGCCACTGAACGATGATAC
>probe:Drosophila_2:1625143_at:586:443; Interrogation_Position=73; Antisense; GATGATACCATCACCAAGTTCTTGG
>probe:Drosophila_2:1625143_at:318:217; Interrogation_Position=88; Antisense; AAGTTCTTGGCCAACCAGGATACGG

Paste this into a BLAST search page for me
AACCAGGATACGGACGGCACCTACGCACCTACGCCTATGATATCGAGCAGATGTACAAGCTCCTTCTCGTCGTCGTCGAGCAGGCCAGCGGTATCCAGATGAAGCTCACGGATCGTACTCCTACATACTCCTACATCTCTCCCGAGGGTAGGTATTCCCGTCCAGGTGGTGTACATCCAGGTGGTGTACACCGCCGATGAGATGAGTTCGGCTTCCACCCACAGTACCACCAATCCCAGAGGAGATCCTGAGCTGGCCGATCGTGCTGTTCGCGCTGGCCGCGCCACTGAACGATGATACGATGATACCATCACCAAGTTCTTGGAAGTTCTTGGCCAACCAGGATACGG

Full Affymetrix probeset data:

Annotations for 1625143_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720