Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625144_at:

>probe:Drosophila_2:1625144_at:271:229; Interrogation_Position=1831; Antisense; AATGTGCCCACACGATCGCGGAGTG
>probe:Drosophila_2:1625144_at:724:85; Interrogation_Position=1852; Antisense; AGTGCTTCGCGGGATCACAACGAGC
>probe:Drosophila_2:1625144_at:380:445; Interrogation_Position=1899; Antisense; GATGAACGCCATTCGCAATTCGCGA
>probe:Drosophila_2:1625144_at:698:623; Interrogation_Position=1988; Antisense; TGCGCTGCAATGTGCAATCCCTGTT
>probe:Drosophila_2:1625144_at:534:235; Interrogation_Position=2003; Antisense; AATCCCTGTTCGTGTGTGACATCTC
>probe:Drosophila_2:1625144_at:430:401; Interrogation_Position=2020; Antisense; GACATCTCCGGCATTTTGGACAGCA
>probe:Drosophila_2:1625144_at:706:341; Interrogation_Position=2088; Antisense; GCTTAAGGGTGCTCCGGATCGGCTA
>probe:Drosophila_2:1625144_at:537:415; Interrogation_Position=2121; Antisense; GAGCCTCATTGCTGGCAACGGCGAG
>probe:Drosophila_2:1625144_at:115:399; Interrogation_Position=2175; Antisense; GACACTAACGGACATCACACATCAT
>probe:Drosophila_2:1625144_at:593:597; Interrogation_Position=2201; Antisense; TGTCCAATTCCATACACTTCCTGAG
>probe:Drosophila_2:1625144_at:627:149; Interrogation_Position=2216; Antisense; ACTTCCTGAGTGTGCCACGTGATAT
>probe:Drosophila_2:1625144_at:612:13; Interrogation_Position=2239; Antisense; ATTATCTAAGCTCTGAACCGACGCC
>probe:Drosophila_2:1625144_at:706:501; Interrogation_Position=2265; Antisense; GTCCTAGTCCAACGTTACGCGGATA
>probe:Drosophila_2:1625144_at:29:659; Interrogation_Position=2288; Antisense; TAGCACTTTGTTGCTGGTAACCCCA

Paste this into a BLAST search page for me
AATGTGCCCACACGATCGCGGAGTGAGTGCTTCGCGGGATCACAACGAGCGATGAACGCCATTCGCAATTCGCGATGCGCTGCAATGTGCAATCCCTGTTAATCCCTGTTCGTGTGTGACATCTCGACATCTCCGGCATTTTGGACAGCAGCTTAAGGGTGCTCCGGATCGGCTAGAGCCTCATTGCTGGCAACGGCGAGGACACTAACGGACATCACACATCATTGTCCAATTCCATACACTTCCTGAGACTTCCTGAGTGTGCCACGTGATATATTATCTAAGCTCTGAACCGACGCCGTCCTAGTCCAACGTTACGCGGATATAGCACTTTGTTGCTGGTAACCCCA

Full Affymetrix probeset data:

Annotations for 1625144_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime