FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625149_at:

>probe:Drosophila_2:1625149_at:75:3; Interrogation_Position=1019; Antisense; GGGCTTCGGAACTCTTTTGGCTGGA
>probe:Drosophila_2:1625149_at:473:433; Interrogation_Position=1044; Antisense; GAGTGTGTTCGGCTTTTATCCAGTC
>probe:Drosophila_2:1625149_at:437:567; Interrogation_Position=1118; Antisense; GGCACATGGAAACGCTCACCGAGGA
>probe:Drosophila_2:1625149_at:667:81; Interrogation_Position=1154; Antisense; AGGGTCTGCTGTGGCTTTTCCGCAA
>probe:Drosophila_2:1625149_at:481:717; Interrogation_Position=1171; Antisense; TTCCGCAAGTTCCTGCCATTTGAAA
>probe:Drosophila_2:1625149_at:392:691; Interrogation_Position=1189; Antisense; TTTGAAACTGCCCATCCAGTGCGAA
>probe:Drosophila_2:1625149_at:321:369; Interrogation_Position=1211; Antisense; GAATGCTGCGCACTCAATGGCATGC
>probe:Drosophila_2:1625149_at:613:49; Interrogation_Position=1232; Antisense; ATGCGAATCCCAACTTCCGAGGCAG
>probe:Drosophila_2:1625149_at:43:209; Interrogation_Position=1375; Antisense; AAGCACTTCTACTCAACGGTCCATG
>probe:Drosophila_2:1625149_at:234:71; Interrogation_Position=1424; Antisense; AGGCGGAACGATTGCACCTCTACTA
>probe:Drosophila_2:1625149_at:673:293; Interrogation_Position=896; Antisense; CGATCGAGGGTCTTAAGCTGGGCAC
>probe:Drosophila_2:1625149_at:712:119; Interrogation_Position=911; Antisense; AGCTGGGCACCGTAGACAAGTTCTT
>probe:Drosophila_2:1625149_at:46:431; Interrogation_Position=940; Antisense; GAGTTTGAGAATCCTCCGCTGCCAG
>probe:Drosophila_2:1625149_at:532:3; Interrogation_Position=968; Antisense; ATTGGCCTGGCTTCAATTGTCTTTG

Paste this into a BLAST search page for me
GGGCTTCGGAACTCTTTTGGCTGGAGAGTGTGTTCGGCTTTTATCCAGTCGGCACATGGAAACGCTCACCGAGGAAGGGTCTGCTGTGGCTTTTCCGCAATTCCGCAAGTTCCTGCCATTTGAAATTTGAAACTGCCCATCCAGTGCGAAGAATGCTGCGCACTCAATGGCATGCATGCGAATCCCAACTTCCGAGGCAGAAGCACTTCTACTCAACGGTCCATGAGGCGGAACGATTGCACCTCTACTACGATCGAGGGTCTTAAGCTGGGCACAGCTGGGCACCGTAGACAAGTTCTTGAGTTTGAGAATCCTCCGCTGCCAGATTGGCCTGGCTTCAATTGTCTTTG

Full Affymetrix probeset data:

Annotations for 1625149_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720