FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625151_at:

>probe:Drosophila_2:1625151_at:546:87; Interrogation_Position=1096; Antisense; AGTCCGCTCCTCGATGTCATGAACA
>probe:Drosophila_2:1625151_at:310:61; Interrogation_Position=1109; Antisense; ATGTCATGAACACGCCAACGGGAGC
>probe:Drosophila_2:1625151_at:308:531; Interrogation_Position=1145; Antisense; GGGTCTATACACTCGCCGAGGAAAC
>probe:Drosophila_2:1625151_at:692:73; Interrogation_Position=1163; Antisense; AGGAAACGGAACTCGAGCTGCAGGA
>probe:Drosophila_2:1625151_at:275:263; Interrogation_Position=634; Antisense; CTGCGACGGGAATCGAATGCCACCA
>probe:Drosophila_2:1625151_at:185:233; Interrogation_Position=649; Antisense; AATGCCACCACCTGGTTTTGTTCGG
>probe:Drosophila_2:1625151_at:710:651; Interrogation_Position=680; Antisense; TAATGTCGGGCATGACGCTAACGGC
>probe:Drosophila_2:1625151_at:103:411; Interrogation_Position=693; Antisense; GACGCTAACGGCCATGTGTTTCAAT
>probe:Drosophila_2:1625151_at:309:437; Interrogation_Position=727; Antisense; GAGGAGATTGTCCATCGCATTCGCA
>probe:Drosophila_2:1625151_at:395:271; Interrogation_Position=739; Antisense; CATCGCATTCGCATTGTGGTGGAGT
>probe:Drosophila_2:1625151_at:177:477; Interrogation_Position=762; Antisense; GTTTAAGAAGACGAGTGCCGCTAAC
>probe:Drosophila_2:1625151_at:329:437; Interrogation_Position=868; Antisense; GAGGAGGACACACCCACATCGCTGG
>probe:Drosophila_2:1625151_at:652:71; Interrogation_Position=899; Antisense; AGGACTACGTAAACCACGAGCTGGT
>probe:Drosophila_2:1625151_at:158:121; Interrogation_Position=917; Antisense; AGCTGGTGCCCATCCTAACAATGGA

Paste this into a BLAST search page for me
AGTCCGCTCCTCGATGTCATGAACAATGTCATGAACACGCCAACGGGAGCGGGTCTATACACTCGCCGAGGAAACAGGAAACGGAACTCGAGCTGCAGGACTGCGACGGGAATCGAATGCCACCAAATGCCACCACCTGGTTTTGTTCGGTAATGTCGGGCATGACGCTAACGGCGACGCTAACGGCCATGTGTTTCAATGAGGAGATTGTCCATCGCATTCGCACATCGCATTCGCATTGTGGTGGAGTGTTTAAGAAGACGAGTGCCGCTAACGAGGAGGACACACCCACATCGCTGGAGGACTACGTAAACCACGAGCTGGTAGCTGGTGCCCATCCTAACAATGGA

Full Affymetrix probeset data:

Annotations for 1625151_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720