FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625156_at:

>probe:Drosophila_2:1625156_at:128:89; Interrogation_Position=218; Antisense; AGTCTCGGCTTCACGCAATCAAGTG
>probe:Drosophila_2:1625156_at:366:545; Interrogation_Position=258; Antisense; GGATCAGGTTTTGAAGGCCTTCGAC
>probe:Drosophila_2:1625156_at:96:529; Interrogation_Position=331; Antisense; GGGATCATTGGTACCGGAGAACTCA
>probe:Drosophila_2:1625156_at:576:443; Interrogation_Position=364; Antisense; GATGATGGTCCTGCTATGCGATCCA
>probe:Drosophila_2:1625156_at:357:189; Interrogation_Position=400; Antisense; AACATCATGGGCACCGTTTACTGTG
>probe:Drosophila_2:1625156_at:330:327; Interrogation_Position=428; Antisense; GCGAGTCCTTCCGTTCGATGAAAAG
>probe:Drosophila_2:1625156_at:418:381; Interrogation_Position=458; Antisense; GAACCGAGGGCCACGTGGTCATCGT
>probe:Drosophila_2:1625156_at:39:95; Interrogation_Position=581; Antisense; AGATCTACCGCCAGGAGTTCCAGAG
>probe:Drosophila_2:1625156_at:258:625; Interrogation_Position=615; Antisense; TGCCGTGAGGGTTTCGACAGTCAGT
>probe:Drosophila_2:1625156_at:247:89; Interrogation_Position=633; Antisense; AGTCAGTCCCGGCATAGTTGATACG
>probe:Drosophila_2:1625156_at:560:27; Interrogation_Position=653; Antisense; ATACGGTCATCTTGCCGGAGCAGAT
>probe:Drosophila_2:1625156_at:295:189; Interrogation_Position=695; Antisense; AACATATGCCCATGCTGCGAAGTGA
>probe:Drosophila_2:1625156_at:623:439; Interrogation_Position=730; Antisense; GATGCCGTTCTCTGGGCAATTGGCA
>probe:Drosophila_2:1625156_at:191:629; Interrogation_Position=756; Antisense; TCCACCCAATGTTCAGGTCCATAAT

Paste this into a BLAST search page for me
AGTCTCGGCTTCACGCAATCAAGTGGGATCAGGTTTTGAAGGCCTTCGACGGGATCATTGGTACCGGAGAACTCAGATGATGGTCCTGCTATGCGATCCAAACATCATGGGCACCGTTTACTGTGGCGAGTCCTTCCGTTCGATGAAAAGGAACCGAGGGCCACGTGGTCATCGTAGATCTACCGCCAGGAGTTCCAGAGTGCCGTGAGGGTTTCGACAGTCAGTAGTCAGTCCCGGCATAGTTGATACGATACGGTCATCTTGCCGGAGCAGATAACATATGCCCATGCTGCGAAGTGAGATGCCGTTCTCTGGGCAATTGGCATCCACCCAATGTTCAGGTCCATAAT

Full Affymetrix probeset data:

Annotations for 1625156_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720