FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625157_at:

>probe:Drosophila_2:1625157_at:307:523; Interrogation_Position=122; Antisense; GGGCCAATATATGCATCTGTCGCGC
>probe:Drosophila_2:1625157_at:607:377; Interrogation_Position=159; Antisense; GAACCTTTCGACAAGGCGCTTTGGT
>probe:Drosophila_2:1625157_at:579:275; Interrogation_Position=177; Antisense; CTTTGGTGCTTCTCGTACGTTATAA
>probe:Drosophila_2:1625157_at:48:33; Interrogation_Position=198; Antisense; ATAATACCATCGAAGCCTCTGCATT
>probe:Drosophila_2:1625157_at:493:697; Interrogation_Position=236; Antisense; TTTCTTGCACAATATCCCAGCTTAT
>probe:Drosophila_2:1625157_at:668:455; Interrogation_Position=267; Antisense; GATTTAATTGCCATGGTCACCGGAC
>probe:Drosophila_2:1625157_at:704:493; Interrogation_Position=282; Antisense; GTCACCGGACAAAAGCGCATCTATG
>probe:Drosophila_2:1625157_at:25:407; Interrogation_Position=30; Antisense; GACTGCAGATTTAAGCTCCGCGAGA
>probe:Drosophila_2:1625157_at:5:571; Interrogation_Position=311; Antisense; GGCATACGGGAAGATCTCTCGCATA
>probe:Drosophila_2:1625157_at:277:563; Interrogation_Position=370; Antisense; GGAAGTTCGCCCATCGCAACATTGA
>probe:Drosophila_2:1625157_at:385:415; Interrogation_Position=423; Antisense; GAGCGTTCGGTGCTGCAGTTTAACA
>probe:Drosophila_2:1625157_at:623:243; Interrogation_Position=469; Antisense; AATATTTTCGCTCATACCTCAGCGG
>probe:Drosophila_2:1625157_at:104:395; Interrogation_Position=68; Antisense; GAAATCGGAGTTGCCCGTATACAAC
>probe:Drosophila_2:1625157_at:472:665; Interrogation_Position=87; Antisense; TACAACTACGTGTCCGATGCGAACA

Paste this into a BLAST search page for me
GGGCCAATATATGCATCTGTCGCGCGAACCTTTCGACAAGGCGCTTTGGTCTTTGGTGCTTCTCGTACGTTATAAATAATACCATCGAAGCCTCTGCATTTTTCTTGCACAATATCCCAGCTTATGATTTAATTGCCATGGTCACCGGACGTCACCGGACAAAAGCGCATCTATGGACTGCAGATTTAAGCTCCGCGAGAGGCATACGGGAAGATCTCTCGCATAGGAAGTTCGCCCATCGCAACATTGAGAGCGTTCGGTGCTGCAGTTTAACAAATATTTTCGCTCATACCTCAGCGGGAAATCGGAGTTGCCCGTATACAACTACAACTACGTGTCCGATGCGAACA

Full Affymetrix probeset data:

Annotations for 1625157_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720