FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625158_at:

>probe:Drosophila_2:1625158_at:371:85; Interrogation_Position=1013; Antisense; AGTGCAAGGACTTTGTGGCTCGCTA
>probe:Drosophila_2:1625158_at:118:89; Interrogation_Position=1067; Antisense; AGTCACGCTACCAGTGCTACTATAA
>probe:Drosophila_2:1625158_at:87:519; Interrogation_Position=1114; Antisense; GTGGTTGCACGCTACGATTTGGACA
>probe:Drosophila_2:1625158_at:460:667; Interrogation_Position=1144; Antisense; TACAGGGAGCTTCTAGTCTCGCTGA
>probe:Drosophila_2:1625158_at:284:5; Interrogation_Position=1177; Antisense; ATTGTGCTCTTTGTGATCTCATCTA
>probe:Drosophila_2:1625158_at:390:59; Interrogation_Position=1209; Antisense; ATGTATCATCACCAAATCCGTCAAG
>probe:Drosophila_2:1625158_at:153:253; Interrogation_Position=1248; Antisense; CAAGATGCGCTGTGTTTGTGCCGGC
>probe:Drosophila_2:1625158_at:363:463; Interrogation_Position=1276; Antisense; GATTCAGATAATGATGGCCCCTTTG
>probe:Drosophila_2:1625158_at:131:409; Interrogation_Position=1348; Antisense; GACGATGTAGTTGACCTGGAGCACC
>probe:Drosophila_2:1625158_at:428:41; Interrogation_Position=1432; Antisense; ATCGGTAGCACCAAGTCGTTGATAC
>probe:Drosophila_2:1625158_at:11:725; Interrogation_Position=1450; Antisense; TTGATACCAATCAGTCCCGTCGGAG
>probe:Drosophila_2:1625158_at:244:171; Interrogation_Position=1516; Antisense; AAAGCAACTACGTGCGATGTTCCCG
>probe:Drosophila_2:1625158_at:457:443; Interrogation_Position=1531; Antisense; GATGTTCCCGAGAAACCACTAGTCA
>probe:Drosophila_2:1625158_at:14:203; Interrogation_Position=979; Antisense; AACCTGGAGGGCTGCGTGAACACAC

Paste this into a BLAST search page for me
AGTGCAAGGACTTTGTGGCTCGCTAAGTCACGCTACCAGTGCTACTATAAGTGGTTGCACGCTACGATTTGGACATACAGGGAGCTTCTAGTCTCGCTGAATTGTGCTCTTTGTGATCTCATCTAATGTATCATCACCAAATCCGTCAAGCAAGATGCGCTGTGTTTGTGCCGGCGATTCAGATAATGATGGCCCCTTTGGACGATGTAGTTGACCTGGAGCACCATCGGTAGCACCAAGTCGTTGATACTTGATACCAATCAGTCCCGTCGGAGAAAGCAACTACGTGCGATGTTCCCGGATGTTCCCGAGAAACCACTAGTCAAACCTGGAGGGCTGCGTGAACACAC

Full Affymetrix probeset data:

Annotations for 1625158_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720