Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625162_at:

>probe:Drosophila_2:1625162_at:188:633; Interrogation_Position=1679; Antisense; TCGCTTTGGGTTGTCGCACGCAGGA
>probe:Drosophila_2:1625162_at:71:271; Interrogation_Position=1773; Antisense; CATGCTGCGGCAGGGATGTGCTAAC
>probe:Drosophila_2:1625162_at:544:185; Interrogation_Position=1795; Antisense; AACAAATCCTTTAGCTACGTCAACG
>probe:Drosophila_2:1625162_at:1:205; Interrogation_Position=1852; Antisense; AAGCCAAATGAAGCCTTCCTGCGGC
>probe:Drosophila_2:1625162_at:596:567; Interrogation_Position=1874; Antisense; GGCACCTGCACAACTTTCACAGAGG
>probe:Drosophila_2:1625162_at:33:625; Interrogation_Position=1902; Antisense; TGCGCGAGCCATTGATGCCAGACAT
>probe:Drosophila_2:1625162_at:380:271; Interrogation_Position=1928; Antisense; CATCAACCAAGACGGCAGCCTTTAA
>probe:Drosophila_2:1625162_at:329:373; Interrogation_Position=1953; Antisense; GAAGGGCCACTCTAAGTTCTGTGAT
>probe:Drosophila_2:1625162_at:260:471; Interrogation_Position=1968; Antisense; GTTCTGTGATAAATACCGCCTGTAC
>probe:Drosophila_2:1625162_at:249:407; Interrogation_Position=2006; Antisense; GACTGTCCGGTCTCAAGCTGGAGGA
>probe:Drosophila_2:1625162_at:661:75; Interrogation_Position=2048; Antisense; AGGAGCGCCCGTATGACCAGTTCAA
>probe:Drosophila_2:1625162_at:329:119; Interrogation_Position=2072; Antisense; AGCTGCCGCCTGTCAACGGAATGGA
>probe:Drosophila_2:1625162_at:224:455; Interrogation_Position=2160; Antisense; GATACACGAGCTGAAGGATGACCCT
>probe:Drosophila_2:1625162_at:584:443; Interrogation_Position=2176; Antisense; GATGACCCTCCCAAAGAGTCTTTGA

Paste this into a BLAST search page for me
TCGCTTTGGGTTGTCGCACGCAGGACATGCTGCGGCAGGGATGTGCTAACAACAAATCCTTTAGCTACGTCAACGAAGCCAAATGAAGCCTTCCTGCGGCGGCACCTGCACAACTTTCACAGAGGTGCGCGAGCCATTGATGCCAGACATCATCAACCAAGACGGCAGCCTTTAAGAAGGGCCACTCTAAGTTCTGTGATGTTCTGTGATAAATACCGCCTGTACGACTGTCCGGTCTCAAGCTGGAGGAAGGAGCGCCCGTATGACCAGTTCAAAGCTGCCGCCTGTCAACGGAATGGAGATACACGAGCTGAAGGATGACCCTGATGACCCTCCCAAAGAGTCTTTGA

Full Affymetrix probeset data:

Annotations for 1625162_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime