FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625163_at:

>probe:Drosophila_2:1625163_at:620:65; Interrogation_Position=445; Antisense; ATGGAGTACCGCCTGGTCAAGATCC
>probe:Drosophila_2:1625163_at:517:649; Interrogation_Position=461; Antisense; TCAAGATCCGTGGACGTTTCCTTCA
>probe:Drosophila_2:1625163_at:240:317; Interrogation_Position=500; Antisense; GCCTGGGTCCGAGATCGCTGATACG
>probe:Drosophila_2:1625163_at:114:447; Interrogation_Position=519; Antisense; GATACGGCCCGATGGCGTGGAAACC
>probe:Drosophila_2:1625163_at:182:225; Interrogation_Position=545; Antisense; AAGGAGGACTCTTCTCGCAGCGCGA
>probe:Drosophila_2:1625163_at:541:325; Interrogation_Position=566; Antisense; GCGACTCGGGCAATGGCTATCTAAT
>probe:Drosophila_2:1625163_at:276:653; Interrogation_Position=587; Antisense; TAATAGTAACCCCTTTTCAGCTGGC
>probe:Drosophila_2:1625163_at:172:77; Interrogation_Position=732; Antisense; AGGAGAGGCGCGTCCGCAGTTCACA
>probe:Drosophila_2:1625163_at:216:223; Interrogation_Position=766; Antisense; AAGGGCAATGTCTATCTCTATCGCG
>probe:Drosophila_2:1625163_at:9:77; Interrogation_Position=816; Antisense; AGGAGCAGCTCCTGTGTTCCTGGAC
>probe:Drosophila_2:1625163_at:254:573; Interrogation_Position=861; Antisense; GGCTGCACATGCTCCAATCGGTGGA
>probe:Drosophila_2:1625163_at:15:237; Interrogation_Position=876; Antisense; AATCGGTGGACAGACACGCGTTACC
>probe:Drosophila_2:1625163_at:159:199; Interrogation_Position=907; Antisense; AACGATCATCTGTCGTACCTGGTGA
>probe:Drosophila_2:1625163_at:635:671; Interrogation_Position=922; Antisense; TACCTGGTGACCTGGTTCAGTCTAT

Paste this into a BLAST search page for me
ATGGAGTACCGCCTGGTCAAGATCCTCAAGATCCGTGGACGTTTCCTTCAGCCTGGGTCCGAGATCGCTGATACGGATACGGCCCGATGGCGTGGAAACCAAGGAGGACTCTTCTCGCAGCGCGAGCGACTCGGGCAATGGCTATCTAATTAATAGTAACCCCTTTTCAGCTGGCAGGAGAGGCGCGTCCGCAGTTCACAAAGGGCAATGTCTATCTCTATCGCGAGGAGCAGCTCCTGTGTTCCTGGACGGCTGCACATGCTCCAATCGGTGGAAATCGGTGGACAGACACGCGTTACCAACGATCATCTGTCGTACCTGGTGATACCTGGTGACCTGGTTCAGTCTAT

Full Affymetrix probeset data:

Annotations for 1625163_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720