Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625164_at:

>probe:Drosophila_2:1625164_at:347:343; Interrogation_Position=150; Antisense; GCTTAACATCTTTCACAATCCATTT
>probe:Drosophila_2:1625164_at:603:91; Interrogation_Position=16; Antisense; AGTTTCCATCATCCCATCAAGCAAG
>probe:Drosophila_2:1625164_at:492:21; Interrogation_Position=200; Antisense; ATATTCCGCAGCTAATCGCTTTTTA
>probe:Drosophila_2:1625164_at:647:23; Interrogation_Position=231; Antisense; ATATCCTACAGATGTTCCTCTATCC
>probe:Drosophila_2:1625164_at:261:683; Interrogation_Position=251; Antisense; TATCCGACGCAGACAGGCAACAATT
>probe:Drosophila_2:1625164_at:608:461; Interrogation_Position=292; Antisense; GATTACAGAGAATACCGGGCAGTTT
>probe:Drosophila_2:1625164_at:258:541; Interrogation_Position=318; Antisense; GGTTGATGGTGCACCACCTCAAGGA
>probe:Drosophila_2:1625164_at:480:727; Interrogation_Position=362; Antisense; TTGGACACTTCCTAGGCAGAGTCGG
>probe:Drosophila_2:1625164_at:441:381; Interrogation_Position=386; Antisense; GAACCCGGTATATTTCGTCTCTGTT
>probe:Drosophila_2:1625164_at:546:225; Interrogation_Position=429; Antisense; AAGGAAATCCAACCATGCATACATA
>probe:Drosophila_2:1625164_at:224:179; Interrogation_Position=470; Antisense; AAACTTGCCTTTTGTACTTTCATGC
>probe:Drosophila_2:1625164_at:52:621; Interrogation_Position=492; Antisense; TGCTATTCATACATTCTGGATCTAT
>probe:Drosophila_2:1625164_at:500:263; Interrogation_Position=60; Antisense; CAGCTTGCTAATATGCGTGTTCTTA
>probe:Drosophila_2:1625164_at:650:569; Interrogation_Position=85; Antisense; GGCATAGTTCCTTTTGCAACTGCTA

Paste this into a BLAST search page for me
GCTTAACATCTTTCACAATCCATTTAGTTTCCATCATCCCATCAAGCAAGATATTCCGCAGCTAATCGCTTTTTAATATCCTACAGATGTTCCTCTATCCTATCCGACGCAGACAGGCAACAATTGATTACAGAGAATACCGGGCAGTTTGGTTGATGGTGCACCACCTCAAGGATTGGACACTTCCTAGGCAGAGTCGGGAACCCGGTATATTTCGTCTCTGTTAAGGAAATCCAACCATGCATACATAAAACTTGCCTTTTGTACTTTCATGCTGCTATTCATACATTCTGGATCTATCAGCTTGCTAATATGCGTGTTCTTAGGCATAGTTCCTTTTGCAACTGCTA

Full Affymetrix probeset data:

Annotations for 1625164_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime