FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625165_at:

>probe:Drosophila_2:1625165_at:570:109; Interrogation_Position=1136; Antisense; AGCAACTATGCAGCTGATTTATAAT
>probe:Drosophila_2:1625165_at:49:173; Interrogation_Position=654; Antisense; AACAGCCGGTCCAGTTTGATTCCGC
>probe:Drosophila_2:1625165_at:671:299; Interrogation_Position=676; Antisense; CGCCCAGCATCGCATCAAGATGAAG
>probe:Drosophila_2:1625165_at:337:381; Interrogation_Position=710; Antisense; GAACCTGGCCAGGATTACACACAGC
>probe:Drosophila_2:1625165_at:128:667; Interrogation_Position=725; Antisense; TACACACAGCAAGAGCTGCTCAAGT
>probe:Drosophila_2:1625165_at:608:521; Interrogation_Position=773; Antisense; GTGGCCCTGGTGGTCAACAGCAAGC
>probe:Drosophila_2:1625165_at:31:135; Interrogation_Position=827; Antisense; ACGCGCGAAGCCTGCGACATGGTCT
>probe:Drosophila_2:1625165_at:37:295; Interrogation_Position=841; Antisense; CGACATGGTCTTGGCCTACGAAAAA
>probe:Drosophila_2:1625165_at:280:617; Interrogation_Position=885; Antisense; TGCACTTCGAGTGGGTAACGCCGCC
>probe:Drosophila_2:1625165_at:613:397; Interrogation_Position=917; Antisense; GACAAGCAGACAACCAAATCGGCCA
>probe:Drosophila_2:1625165_at:596:165; Interrogation_Position=932; Antisense; AAATCGGCCACCACTGGGTGCAGTG
>probe:Drosophila_2:1625165_at:26:87; Interrogation_Position=953; Antisense; AGTGCGTCATCCACCGACTACGAGG
>probe:Drosophila_2:1625165_at:345:437; Interrogation_Position=974; Antisense; GAGGACCTGGTCATGCGAAAGCTGC
>probe:Drosophila_2:1625165_at:195:173; Interrogation_Position=991; Antisense; AAAGCTGCGCCAAGCTGAGGAACGT

Paste this into a BLAST search page for me
AGCAACTATGCAGCTGATTTATAATAACAGCCGGTCCAGTTTGATTCCGCCGCCCAGCATCGCATCAAGATGAAGGAACCTGGCCAGGATTACACACAGCTACACACAGCAAGAGCTGCTCAAGTGTGGCCCTGGTGGTCAACAGCAAGCACGCGCGAAGCCTGCGACATGGTCTCGACATGGTCTTGGCCTACGAAAAATGCACTTCGAGTGGGTAACGCCGCCGACAAGCAGACAACCAAATCGGCCAAAATCGGCCACCACTGGGTGCAGTGAGTGCGTCATCCACCGACTACGAGGGAGGACCTGGTCATGCGAAAGCTGCAAAGCTGCGCCAAGCTGAGGAACGT

Full Affymetrix probeset data:

Annotations for 1625165_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720