FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625166_at:

>probe:Drosophila_2:1625166_at:504:401; Interrogation_Position=109; Antisense; GACATATCCTGTCGCACGGGACGGC
>probe:Drosophila_2:1625166_at:534:529; Interrogation_Position=135; Antisense; GGGATCCTTCGAGGTGTCCATCGAC
>probe:Drosophila_2:1625166_at:34:505; Interrogation_Position=150; Antisense; GTCCATCGACGGTCAGCTAGTGCAC
>probe:Drosophila_2:1625166_at:716:537; Interrogation_Position=160; Antisense; GGTCAGCTAGTGCACTCGAAGCTTT
>probe:Drosophila_2:1625166_at:47:637; Interrogation_Position=175; Antisense; TCGAAGCTTTCCTGCCTGGCATTTC
>probe:Drosophila_2:1625166_at:586:581; Interrogation_Position=191; Antisense; TGGCATTTCCCCAGCACGCGAGTGT
>probe:Drosophila_2:1625166_at:612:83; Interrogation_Position=211; Antisense; AGTGTCCTGGCCCAAGTGCAGAAGG
>probe:Drosophila_2:1625166_at:335:435; Interrogation_Position=25; Antisense; GAGGTGGAATACTGCGGCATCTGCA
>probe:Drosophila_2:1625166_at:721:587; Interrogation_Position=254; Antisense; TGGAGAAAGTCCTGGAGCAGCCCAT
>probe:Drosophila_2:1625166_at:283:125; Interrogation_Position=272; Antisense; AGCCCATCAAGGACTGCGTCGTGAT
>probe:Drosophila_2:1625166_at:569:331; Interrogation_Position=38; Antisense; GCGGCATCTGCAACTTTAGCGGGCA
>probe:Drosophila_2:1625166_at:91:643; Interrogation_Position=44; Antisense; TCTGCAACTTTAGCGGGCAGTGCCA
>probe:Drosophila_2:1625166_at:96:569; Interrogation_Position=59; Antisense; GGCAGTGCCACCTGCTGCGCGAGTT
>probe:Drosophila_2:1625166_at:204:503; Interrogation_Position=96; Antisense; GTCGCCCGACTTGGACATATCCTGT

Paste this into a BLAST search page for me
GACATATCCTGTCGCACGGGACGGCGGGATCCTTCGAGGTGTCCATCGACGTCCATCGACGGTCAGCTAGTGCACGGTCAGCTAGTGCACTCGAAGCTTTTCGAAGCTTTCCTGCCTGGCATTTCTGGCATTTCCCCAGCACGCGAGTGTAGTGTCCTGGCCCAAGTGCAGAAGGGAGGTGGAATACTGCGGCATCTGCATGGAGAAAGTCCTGGAGCAGCCCATAGCCCATCAAGGACTGCGTCGTGATGCGGCATCTGCAACTTTAGCGGGCATCTGCAACTTTAGCGGGCAGTGCCAGGCAGTGCCACCTGCTGCGCGAGTTGTCGCCCGACTTGGACATATCCTGT

Full Affymetrix probeset data:

Annotations for 1625166_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720