Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625169_at:

>probe:Drosophila_2:1625169_at:491:303; Interrogation_Position=1016; Antisense; CCGAGGCTTGGTGGCCCATACAAAA
>probe:Drosophila_2:1625169_at:425:3; Interrogation_Position=1097; Antisense; ATTGGCAACCTAACCCTCAATTATT
>probe:Drosophila_2:1625169_at:8:281; Interrogation_Position=1112; Antisense; CTCAATTATTACCACCTTCTTTCTA
>probe:Drosophila_2:1625169_at:695:647; Interrogation_Position=1179; Antisense; TCAGTTTACTACTTCGCTACCATAA
>probe:Drosophila_2:1625169_at:684:109; Interrogation_Position=692; Antisense; AGAAGGCGCTTCTCAAGCAGCATCG
>probe:Drosophila_2:1625169_at:67:115; Interrogation_Position=710; Antisense; AGCATCGCACCCAGGTTCATTTAAT
>probe:Drosophila_2:1625169_at:281:709; Interrogation_Position=734; Antisense; TTAACCGCAGGTTCCAGTGCACCAT
>probe:Drosophila_2:1625169_at:446:333; Interrogation_Position=829; Antisense; GCTAGCGCAGCACTATATGCAACTT
>probe:Drosophila_2:1625169_at:237:383; Interrogation_Position=882; Antisense; GAACGACCTTATCCATGCCTAGAAT
>probe:Drosophila_2:1625169_at:684:367; Interrogation_Position=910; Antisense; GAATGATCTTCAGCAGCGTTTCCGA
>probe:Drosophila_2:1625169_at:242:325; Interrogation_Position=925; Antisense; GCGTTTCCGAATTGCAGAACCACTT
>probe:Drosophila_2:1625169_at:4:381; Interrogation_Position=941; Antisense; GAACCACTTTTCGACACACTCAAAG
>probe:Drosophila_2:1625169_at:224:533; Interrogation_Position=982; Antisense; GGTGTGAGCCTTGCAACATGGATTT
>probe:Drosophila_2:1625169_at:182:65; Interrogation_Position=999; Antisense; ATGGATTTTATAACTCGCCGAGGCT

Paste this into a BLAST search page for me
CCGAGGCTTGGTGGCCCATACAAAAATTGGCAACCTAACCCTCAATTATTCTCAATTATTACCACCTTCTTTCTATCAGTTTACTACTTCGCTACCATAAAGAAGGCGCTTCTCAAGCAGCATCGAGCATCGCACCCAGGTTCATTTAATTTAACCGCAGGTTCCAGTGCACCATGCTAGCGCAGCACTATATGCAACTTGAACGACCTTATCCATGCCTAGAATGAATGATCTTCAGCAGCGTTTCCGAGCGTTTCCGAATTGCAGAACCACTTGAACCACTTTTCGACACACTCAAAGGGTGTGAGCCTTGCAACATGGATTTATGGATTTTATAACTCGCCGAGGCT

Full Affymetrix probeset data:

Annotations for 1625169_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime