Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625170_at:

>probe:Drosophila_2:1625170_at:171:285; Interrogation_Position=2107; Antisense; CGTAGTCAACTGTCTGGAACCGCAT
>probe:Drosophila_2:1625170_at:285:581; Interrogation_Position=2148; Antisense; TGGCCACCTCTGGACTAGAGCACGA
>probe:Drosophila_2:1625170_at:583:39; Interrogation_Position=2180; Antisense; ATCTGGACACCACAGGGACCTGAAA
>probe:Drosophila_2:1625170_at:295:145; Interrogation_Position=2209; Antisense; ACTCCCCGAGGATTTACTGAAGCAG
>probe:Drosophila_2:1625170_at:148:411; Interrogation_Position=2233; Antisense; GACGCTGCAGCGCAATTTCAGGTGC
>probe:Drosophila_2:1625170_at:538:411; Interrogation_Position=2276; Antisense; GACCTCGACATCAACAATTTCCAGT
>probe:Drosophila_2:1625170_at:272:695; Interrogation_Position=2293; Antisense; TTTCCAGTACTTTATACGCGGCTTC
>probe:Drosophila_2:1625170_at:553:419; Interrogation_Position=2331; Antisense; GAGCATCGCATCTGCGTCAGAGACA
>probe:Drosophila_2:1625170_at:259:29; Interrogation_Position=2355; Antisense; ATACGTCTTCGCTAGGTCATCAAAT
>probe:Drosophila_2:1625170_at:332:167; Interrogation_Position=2376; Antisense; AAATGCGGGACAACAGCTCCAGCCG
>probe:Drosophila_2:1625170_at:43:353; Interrogation_Position=2400; Antisense; GCAGCAACGGCTCGAATGCTTCCAA
>probe:Drosophila_2:1625170_at:541:175; Interrogation_Position=2467; Antisense; AAACGACGAGGGAGCAGACGCCGAC
>probe:Drosophila_2:1625170_at:431:717; Interrogation_Position=2555; Antisense; TTCGAAAGCAGTCCTCGGCGATTAT
>probe:Drosophila_2:1625170_at:160:379; Interrogation_Position=2619; Antisense; GAAGCTGTGAATTTGTAACCGTAAC

Paste this into a BLAST search page for me
CGTAGTCAACTGTCTGGAACCGCATTGGCCACCTCTGGACTAGAGCACGAATCTGGACACCACAGGGACCTGAAAACTCCCCGAGGATTTACTGAAGCAGGACGCTGCAGCGCAATTTCAGGTGCGACCTCGACATCAACAATTTCCAGTTTTCCAGTACTTTATACGCGGCTTCGAGCATCGCATCTGCGTCAGAGACAATACGTCTTCGCTAGGTCATCAAATAAATGCGGGACAACAGCTCCAGCCGGCAGCAACGGCTCGAATGCTTCCAAAAACGACGAGGGAGCAGACGCCGACTTCGAAAGCAGTCCTCGGCGATTATGAAGCTGTGAATTTGTAACCGTAAC

Full Affymetrix probeset data:

Annotations for 1625170_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime