Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625174_at:

>probe:Drosophila_2:1625174_at:302:141; Interrogation_Position=106; Antisense; ACGGCAAGTGCGTAAACTGCTCCCA
>probe:Drosophila_2:1625174_at:338:195; Interrogation_Position=120; Antisense; AACTGCTCCCATGATCAAACGACTA
>probe:Drosophila_2:1625174_at:483:61; Interrogation_Position=182; Antisense; AGGTAGGACGACAGCCCGGCCAAGC
>probe:Drosophila_2:1625174_at:689:55; Interrogation_Position=259; Antisense; ATGACCTGACCGGTGACTGGGCACT
>probe:Drosophila_2:1625174_at:458:567; Interrogation_Position=278; Antisense; GGCACTGCATCAATCGGCTGGAGGA
>probe:Drosophila_2:1625174_at:342:151; Interrogation_Position=310; Antisense; ACATTGGCAGGCGTTCGAAGCGTCA
>probe:Drosophila_2:1625174_at:637:495; Interrogation_Position=331; Antisense; GTCAGTCACGCGGTGGTCAGTACAT
>probe:Drosophila_2:1625174_at:135:495; Interrogation_Position=346; Antisense; GTCAGTACATCGATTTGGGCGGATC
>probe:Drosophila_2:1625174_at:33:307; Interrogation_Position=38; Antisense; CCTGACGTTATTGGCGCTTTTGATC
>probe:Drosophila_2:1625174_at:533:545; Interrogation_Position=402; Antisense; GGATCTGGCATAACCACCATCGATT
>probe:Drosophila_2:1625174_at:721:463; Interrogation_Position=423; Antisense; GATTCCAGTGGCTATCCCGGCGGAA
>probe:Drosophila_2:1625174_at:64:45; Interrogation_Position=436; Antisense; ATCCCGGCGGAACACTGGTGCGCAA
>probe:Drosophila_2:1625174_at:114:293; Interrogation_Position=470; Antisense; CGTCGGTTGCAATATTCGCGGATAA
>probe:Drosophila_2:1625174_at:639:503; Interrogation_Position=81; Antisense; GTCCACGGTGGCAAGGTGACCATCA

Paste this into a BLAST search page for me
ACGGCAAGTGCGTAAACTGCTCCCAAACTGCTCCCATGATCAAACGACTAAGGTAGGACGACAGCCCGGCCAAGCATGACCTGACCGGTGACTGGGCACTGGCACTGCATCAATCGGCTGGAGGAACATTGGCAGGCGTTCGAAGCGTCAGTCAGTCACGCGGTGGTCAGTACATGTCAGTACATCGATTTGGGCGGATCCCTGACGTTATTGGCGCTTTTGATCGGATCTGGCATAACCACCATCGATTGATTCCAGTGGCTATCCCGGCGGAAATCCCGGCGGAACACTGGTGCGCAACGTCGGTTGCAATATTCGCGGATAAGTCCACGGTGGCAAGGTGACCATCA

Full Affymetrix probeset data:

Annotations for 1625174_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime