Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625176_at:

>probe:Drosophila_2:1625176_at:253:217; Interrogation_Position=5575; Antisense; AAGTTGCAAGCAGTACCTTCACCTG
>probe:Drosophila_2:1625176_at:131:91; Interrogation_Position=5586; Antisense; AGTACCTTCACCTGGACACACAGAT
>probe:Drosophila_2:1625176_at:675:157; Interrogation_Position=5601; Antisense; ACACACAGATGCGATTTCAGCCCAA
>probe:Drosophila_2:1625176_at:443:327; Interrogation_Position=5611; Antisense; GCGATTTCAGCCCAAAGTCGACAAT
>probe:Drosophila_2:1625176_at:636:213; Interrogation_Position=5625; Antisense; AAGTCGACAATTATGCCGTTGCCAT
>probe:Drosophila_2:1625176_at:348:245; Interrogation_Position=5633; Antisense; AATTATGCCGTTGCCATTGCTTTCA
>probe:Drosophila_2:1625176_at:451:469; Interrogation_Position=5642; Antisense; GTTGCCATTGCTTTCACACAAGCGA
>probe:Drosophila_2:1625176_at:697:561; Interrogation_Position=5700; Antisense; GGAACTCACAAGGAATCTAACATTT
>probe:Drosophila_2:1625176_at:543:189; Interrogation_Position=5718; Antisense; AACATTTTGCATACCGATTACCTAA
>probe:Drosophila_2:1625176_at:558:615; Interrogation_Position=5725; Antisense; TGCATACCGATTACCTAAGGAACAA
>probe:Drosophila_2:1625176_at:164:561; Interrogation_Position=5743; Antisense; GGAACAACATTTAGCATTAACACAC
>probe:Drosophila_2:1625176_at:257:345; Interrogation_Position=5756; Antisense; GCATTAACACACAAGCGTTTACTAT
>probe:Drosophila_2:1625176_at:627:699; Interrogation_Position=5830; Antisense; TTTTTGTGCAGCCAAGCCCCAAGCG
>probe:Drosophila_2:1625176_at:347:253; Interrogation_Position=5842; Antisense; CAAGCCCCAAGCGACGAGAAATTTT

Paste this into a BLAST search page for me
AAGTTGCAAGCAGTACCTTCACCTGAGTACCTTCACCTGGACACACAGATACACACAGATGCGATTTCAGCCCAAGCGATTTCAGCCCAAAGTCGACAATAAGTCGACAATTATGCCGTTGCCATAATTATGCCGTTGCCATTGCTTTCAGTTGCCATTGCTTTCACACAAGCGAGGAACTCACAAGGAATCTAACATTTAACATTTTGCATACCGATTACCTAATGCATACCGATTACCTAAGGAACAAGGAACAACATTTAGCATTAACACACGCATTAACACACAAGCGTTTACTATTTTTTGTGCAGCCAAGCCCCAAGCGCAAGCCCCAAGCGACGAGAAATTTT

Full Affymetrix probeset data:

Annotations for 1625176_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime