FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625177_at:

>probe:Drosophila_2:1625177_at:313:607; Interrogation_Position=137; Antisense; TGATGTGGACCTGCATGACGCTATA
>probe:Drosophila_2:1625177_at:393:611; Interrogation_Position=152; Antisense; TGACGCTATATAACCGACCGCAAGT
>probe:Drosophila_2:1625177_at:291:85; Interrogation_Position=174; Antisense; AGTGTGCTATACACCCGAACTGCAG
>probe:Drosophila_2:1625177_at:507:573; Interrogation_Position=206; Antisense; GGCTGATTGCACTGATCTGCATCTT
>probe:Drosophila_2:1625177_at:233:397; Interrogation_Position=27; Antisense; GACAATTAGTGCCACGCTCTTCATG
>probe:Drosophila_2:1625177_at:91:639; Interrogation_Position=274; Antisense; TCGTCATCCTGCAACCGGAATGTGA
>probe:Drosophila_2:1625177_at:678:369; Interrogation_Position=291; Antisense; GAATGTGATTCCGTACGCGCGCTGG
>probe:Drosophila_2:1625177_at:404:529; Interrogation_Position=318; Antisense; GGGATTCACGGCCATGGTGCTCTTC
>probe:Drosophila_2:1625177_at:257:633; Interrogation_Position=362; Antisense; TCCCGCTGGGATTCCACGTAGAGGA
>probe:Drosophila_2:1625177_at:348:95; Interrogation_Position=425; Antisense; AGATTGGCATCTCCTACATCATGTT
>probe:Drosophila_2:1625177_at:298:515; Interrogation_Position=475; Antisense; GTGTCTGAGCTCTTTGCCGGCAAGG
>probe:Drosophila_2:1625177_at:282:69; Interrogation_Position=49; Antisense; ATGGCGGCCGATGTCTTTGCGATTG
>probe:Drosophila_2:1625177_at:66:695; Interrogation_Position=64; Antisense; TTTGCGATTGTGAGTCTGGCCCTTC
>probe:Drosophila_2:1625177_at:257:407; Interrogation_Position=91; Antisense; GACTGGATCATCACGGAGTCCGGAA

Paste this into a BLAST search page for me
TGATGTGGACCTGCATGACGCTATATGACGCTATATAACCGACCGCAAGTAGTGTGCTATACACCCGAACTGCAGGGCTGATTGCACTGATCTGCATCTTGACAATTAGTGCCACGCTCTTCATGTCGTCATCCTGCAACCGGAATGTGAGAATGTGATTCCGTACGCGCGCTGGGGGATTCACGGCCATGGTGCTCTTCTCCCGCTGGGATTCCACGTAGAGGAAGATTGGCATCTCCTACATCATGTTGTGTCTGAGCTCTTTGCCGGCAAGGATGGCGGCCGATGTCTTTGCGATTGTTTGCGATTGTGAGTCTGGCCCTTCGACTGGATCATCACGGAGTCCGGAA

Full Affymetrix probeset data:

Annotations for 1625177_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720