FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625178_at:

>probe:Drosophila_2:1625178_at:89:135; Interrogation_Position=2868; Antisense; ACGCGCAGAGCTGTTTGGGCAACCA
>probe:Drosophila_2:1625178_at:91:307; Interrogation_Position=2899; Antisense; CCAGGTCCTCCAAGCATAGTTTTAG
>probe:Drosophila_2:1625178_at:85:463; Interrogation_Position=2955; Antisense; GATTACGAGCGAACTGATCCAAATT
>probe:Drosophila_2:1625178_at:25:247; Interrogation_Position=2976; Antisense; AATTCTGGGTGCACTGGCAGCAGTT
>probe:Drosophila_2:1625178_at:194:211; Interrogation_Position=3018; Antisense; AAGAATCCCGTTGCGAAGCCTAGAT
>probe:Drosophila_2:1625178_at:121:679; Interrogation_Position=3038; Antisense; TAGATTATCTGCTGCTTACCTCAAT
>probe:Drosophila_2:1625178_at:718:675; Interrogation_Position=3095; Antisense; TAGAATTCGTGAGACCAGCCTCTGT
>probe:Drosophila_2:1625178_at:308:123; Interrogation_Position=3111; Antisense; AGCCTCTGTGGTTAGGAGTCCTTTG
>probe:Drosophila_2:1625178_at:711:431; Interrogation_Position=3126; Antisense; GAGTCCTTTGTGATCTTCAGTTGTA
>probe:Drosophila_2:1625178_at:415:13; Interrogation_Position=3163; Antisense; ATTTTTCTCTTGTGGTTTGGGCTGA
>probe:Drosophila_2:1625178_at:147:63; Interrogation_Position=3187; Antisense; ATGGGTTTCACCGATAACACTTGTT
>probe:Drosophila_2:1625178_at:438:515; Interrogation_Position=3255; Antisense; GTGTATCCTGGATCGATCTGCGGAT
>probe:Drosophila_2:1625178_at:402:329; Interrogation_Position=3274; Antisense; GCGGATCCTGTGCATTTGACCAGTA
>probe:Drosophila_2:1625178_at:597:459; Interrogation_Position=3314; Antisense; GATTTTCCCGGCTAGCTGCTGAACA

Paste this into a BLAST search page for me
ACGCGCAGAGCTGTTTGGGCAACCACCAGGTCCTCCAAGCATAGTTTTAGGATTACGAGCGAACTGATCCAAATTAATTCTGGGTGCACTGGCAGCAGTTAAGAATCCCGTTGCGAAGCCTAGATTAGATTATCTGCTGCTTACCTCAATTAGAATTCGTGAGACCAGCCTCTGTAGCCTCTGTGGTTAGGAGTCCTTTGGAGTCCTTTGTGATCTTCAGTTGTAATTTTTCTCTTGTGGTTTGGGCTGAATGGGTTTCACCGATAACACTTGTTGTGTATCCTGGATCGATCTGCGGATGCGGATCCTGTGCATTTGACCAGTAGATTTTCCCGGCTAGCTGCTGAACA

Full Affymetrix probeset data:

Annotations for 1625178_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720