FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625181_at:

>probe:Drosophila_2:1625181_at:348:99; Interrogation_Position=106; Antisense; AGAGTTCTAAGGATGCGTCACGCTG
>probe:Drosophila_2:1625181_at:131:51; Interrogation_Position=118; Antisense; ATGCGTCACGCTGTGATCCTTGTTT
>probe:Drosophila_2:1625181_at:393:47; Interrogation_Position=133; Antisense; ATCCTTGTTTTCGTGTGTTGCCTGC
>probe:Drosophila_2:1625181_at:114:517; Interrogation_Position=145; Antisense; GTGTGTTGCCTGCTGATCGCCTTAA
>probe:Drosophila_2:1625181_at:467:601; Interrogation_Position=158; Antisense; TGATCGCCTTAACCTCAGCCGGTTT
>probe:Drosophila_2:1625181_at:204:201; Interrogation_Position=168; Antisense; AACCTCAGCCGGTTTGCTGGGCGGT
>probe:Drosophila_2:1625181_at:632:23; Interrogation_Position=279; Antisense; CCAAAAGAACGGAGGAGGCGGCCAT
>probe:Drosophila_2:1625181_at:546:329; Interrogation_Position=477; Antisense; GCGGTGGCCATGCAAGCAAGTCCTT
>probe:Drosophila_2:1625181_at:352:623; Interrogation_Position=497; Antisense; TCCTTGGCCGGCAATCGCGGTAGTT
>probe:Drosophila_2:1625181_at:394:45; Interrogation_Position=510; Antisense; ATCGCGGTAGTTCCGTGTCCTGGCA
>probe:Drosophila_2:1625181_at:718:159; Interrogation_Position=619; Antisense; ACAACATGGCGGTGGCTGGTAATCA
>probe:Drosophila_2:1625181_at:691:527; Interrogation_Position=636; Antisense; GGTAATCAAACCACCAGGAGCAGCT
>probe:Drosophila_2:1625181_at:105:77; Interrogation_Position=651; Antisense; AGGAGCAGCTAATCCACCGTCTGAT
>probe:Drosophila_2:1625181_at:195:279; Interrogation_Position=659; Antisense; CTAATCCACCGTCTGATGCTGACTT

Paste this into a BLAST search page for me
AGAGTTCTAAGGATGCGTCACGCTGATGCGTCACGCTGTGATCCTTGTTTATCCTTGTTTTCGTGTGTTGCCTGCGTGTGTTGCCTGCTGATCGCCTTAATGATCGCCTTAACCTCAGCCGGTTTAACCTCAGCCGGTTTGCTGGGCGGTCCAAAAGAACGGAGGAGGCGGCCATGCGGTGGCCATGCAAGCAAGTCCTTTCCTTGGCCGGCAATCGCGGTAGTTATCGCGGTAGTTCCGTGTCCTGGCAACAACATGGCGGTGGCTGGTAATCAGGTAATCAAACCACCAGGAGCAGCTAGGAGCAGCTAATCCACCGTCTGATCTAATCCACCGTCTGATGCTGACTT

Full Affymetrix probeset data:

Annotations for 1625181_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720