Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625183_at:

>probe:Drosophila_2:1625183_at:295:213; Interrogation_Position=3512; Antisense; AAGACGGCAGACAGTTTGATATGAA
>probe:Drosophila_2:1625183_at:507:149; Interrogation_Position=3536; Antisense; ACTTGAGCTGGGTAAGATTGCTTAC
>probe:Drosophila_2:1625183_at:630:463; Interrogation_Position=3551; Antisense; GATTGCTTACCAAATCCAGACTGTA
>probe:Drosophila_2:1625183_at:383:235; Interrogation_Position=3563; Antisense; AATCCAGACTGTAATTTGAACGAAG
>probe:Drosophila_2:1625183_at:591:373; Interrogation_Position=3584; Antisense; GAAGTTTGTAACCTGTAATCCTGTA
>probe:Drosophila_2:1625183_at:281:455; Interrogation_Position=3615; Antisense; GATAACACTGTACACAATTGCAATT
>probe:Drosophila_2:1625183_at:715:359; Interrogation_Position=3634; Antisense; GCAATTTTTGCTCATAACTTTTGAA
>probe:Drosophila_2:1625183_at:353:557; Interrogation_Position=3672; Antisense; GGACTACAATGCCTAAGCCTATATA
>probe:Drosophila_2:1625183_at:730:157; Interrogation_Position=3698; Antisense; ACAAAGCTGCGATCCTTTGGAGCTT
>probe:Drosophila_2:1625183_at:328:447; Interrogation_Position=3708; Antisense; GATCCTTTGGAGCTTGTTTCGTATT
>probe:Drosophila_2:1625183_at:122:553; Interrogation_Position=3716; Antisense; GGAGCTTGTTTCGTATTATTTGTAA
>probe:Drosophila_2:1625183_at:646:183; Interrogation_Position=3739; Antisense; AAAAGTTTTCTCTGCCACTTGTCAT
>probe:Drosophila_2:1625183_at:441:281; Interrogation_Position=3748; Antisense; CTCTGCCACTTGTCATAATTATGTC
>probe:Drosophila_2:1625183_at:687:59; Interrogation_Position=3768; Antisense; ATGTCTTATACTTTCTTTATGGGTT

Paste this into a BLAST search page for me
AAGACGGCAGACAGTTTGATATGAAACTTGAGCTGGGTAAGATTGCTTACGATTGCTTACCAAATCCAGACTGTAAATCCAGACTGTAATTTGAACGAAGGAAGTTTGTAACCTGTAATCCTGTAGATAACACTGTACACAATTGCAATTGCAATTTTTGCTCATAACTTTTGAAGGACTACAATGCCTAAGCCTATATAACAAAGCTGCGATCCTTTGGAGCTTGATCCTTTGGAGCTTGTTTCGTATTGGAGCTTGTTTCGTATTATTTGTAAAAAAGTTTTCTCTGCCACTTGTCATCTCTGCCACTTGTCATAATTATGTCATGTCTTATACTTTCTTTATGGGTT

Full Affymetrix probeset data:

Annotations for 1625183_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime