FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625184_at:

>probe:Drosophila_2:1625184_at:662:551; Interrogation_Position=139; Antisense; GGAGCAACCATTGTTGTCTTTCATG
>probe:Drosophila_2:1625184_at:516:497; Interrogation_Position=154; Antisense; GTCTTTCATGTGGTCATTTCCGTCA
>probe:Drosophila_2:1625184_at:494:19; Interrogation_Position=169; Antisense; ATTTCCGTCATTTCTCTTGGAGGCT
>probe:Drosophila_2:1625184_at:484:437; Interrogation_Position=188; Antisense; GAGGCTTTTATGCACTTGTTTCCAG
>probe:Drosophila_2:1625184_at:395:1; Interrogation_Position=212; Antisense; GTGGAATAAACCTGGTGCCCGTACT
>probe:Drosophila_2:1625184_at:638:505; Interrogation_Position=226; Antisense; GTGCCCGTACTGGAATACTTTGGAA
>probe:Drosophila_2:1625184_at:469:275; Interrogation_Position=243; Antisense; CTTTGGAATGGGTTCATCGGCGGTT
>probe:Drosophila_2:1625184_at:61:391; Interrogation_Position=273; Antisense; GAAAGTTGCCGCAGGAAGCACCTTT
>probe:Drosophila_2:1625184_at:331:377; Interrogation_Position=287; Antisense; GAAGCACCTTTGTTGTGGCCTTTGC
>probe:Drosophila_2:1625184_at:574:521; Interrogation_Position=301; Antisense; GTGGCCTTTGCCGTTCATAAAATCT
>probe:Drosophila_2:1625184_at:367:165; Interrogation_Position=320; Antisense; AAATCTTTGCGCCAGCCAGAATCAG
>probe:Drosophila_2:1625184_at:711:365; Interrogation_Position=338; Antisense; GAATCAGCATCACATTGGGCACCAC
>probe:Drosophila_2:1625184_at:637:353; Interrogation_Position=356; Antisense; GCACCACACCGTTTATCGTGAGGTA
>probe:Drosophila_2:1625184_at:193:535; Interrogation_Position=377; Antisense; GGTATTTGCGATCCAAGGGACTTCT

Paste this into a BLAST search page for me
GGAGCAACCATTGTTGTCTTTCATGGTCTTTCATGTGGTCATTTCCGTCAATTTCCGTCATTTCTCTTGGAGGCTGAGGCTTTTATGCACTTGTTTCCAGGTGGAATAAACCTGGTGCCCGTACTGTGCCCGTACTGGAATACTTTGGAACTTTGGAATGGGTTCATCGGCGGTTGAAAGTTGCCGCAGGAAGCACCTTTGAAGCACCTTTGTTGTGGCCTTTGCGTGGCCTTTGCCGTTCATAAAATCTAAATCTTTGCGCCAGCCAGAATCAGGAATCAGCATCACATTGGGCACCACGCACCACACCGTTTATCGTGAGGTAGGTATTTGCGATCCAAGGGACTTCT

Full Affymetrix probeset data:

Annotations for 1625184_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720