FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625185_at:

>probe:Drosophila_2:1625185_at:271:709; Interrogation_Position=1268; Antisense; TTAAATCGTTAAATGCCTAGCTGGC
>probe:Drosophila_2:1625185_at:174:681; Interrogation_Position=1296; Antisense; TAGGCGTCCAATTAAGCGCTGTAAT
>probe:Drosophila_2:1625185_at:24:335; Interrogation_Position=1313; Antisense; GCTGTAATTTACATTTTCCGCTCTT
>probe:Drosophila_2:1625185_at:237:635; Interrogation_Position=1340; Antisense; TCGCCGTCGCTGTTTGTTGTTCAAA
>probe:Drosophila_2:1625185_at:91:603; Interrogation_Position=1354; Antisense; TGTTGTTCAAACACGAGTCCCGGTA
>probe:Drosophila_2:1625185_at:721:537; Interrogation_Position=1375; Antisense; GGTAATTTCCTTCGGCAAGGACTCA
>probe:Drosophila_2:1625185_at:559:225; Interrogation_Position=1391; Antisense; AAGGACTCAACTGCCGTCAGGACAT
>probe:Drosophila_2:1625185_at:143:649; Interrogation_Position=1407; Antisense; TCAGGACATCCATTCATATCCACAC
>probe:Drosophila_2:1625185_at:481:255; Interrogation_Position=1512; Antisense; CAAATGGGCGGAGCTTCAGCTGGCA
>probe:Drosophila_2:1625185_at:260:259; Interrogation_Position=1535; Antisense; CACGAAACCCTTACTCATCAATTAT
>probe:Drosophila_2:1625185_at:432:33; Interrogation_Position=1551; Antisense; ATCAATTATGCAGCACCTCGCACAG
>probe:Drosophila_2:1625185_at:234:357; Interrogation_Position=1570; Antisense; GCACAGCGACTGTCAACCGAATCGT
>probe:Drosophila_2:1625185_at:590:61; Interrogation_Position=1718; Antisense; ATGTCCTCGCTATTGCACATTGTGA
>probe:Drosophila_2:1625185_at:690:417; Interrogation_Position=1765; Antisense; GAGCTTTTTATTCGTGTACCTTAGA

Paste this into a BLAST search page for me
TTAAATCGTTAAATGCCTAGCTGGCTAGGCGTCCAATTAAGCGCTGTAATGCTGTAATTTACATTTTCCGCTCTTTCGCCGTCGCTGTTTGTTGTTCAAATGTTGTTCAAACACGAGTCCCGGTAGGTAATTTCCTTCGGCAAGGACTCAAAGGACTCAACTGCCGTCAGGACATTCAGGACATCCATTCATATCCACACCAAATGGGCGGAGCTTCAGCTGGCACACGAAACCCTTACTCATCAATTATATCAATTATGCAGCACCTCGCACAGGCACAGCGACTGTCAACCGAATCGTATGTCCTCGCTATTGCACATTGTGAGAGCTTTTTATTCGTGTACCTTAGA

Full Affymetrix probeset data:

Annotations for 1625185_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720