FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625186_at:

>probe:Drosophila_2:1625186_at:393:661; Interrogation_Position=403; Antisense; TAACATTCCAGAATCTTCCGACTCT
>probe:Drosophila_2:1625186_at:36:405; Interrogation_Position=422; Antisense; GACTCTGGGCGATCATGCCGTGAAT
>probe:Drosophila_2:1625186_at:340:255; Interrogation_Position=448; Antisense; CAAACAATCTGTGCGATCTGATCGT
>probe:Drosophila_2:1625186_at:401:449; Interrogation_Position=467; Antisense; GATCGTGGAGACGTTTGGACCCAAG
>probe:Drosophila_2:1625186_at:392:251; Interrogation_Position=488; Antisense; CAAGAGGGATCTGCCACTGCTCATG
>probe:Drosophila_2:1625186_at:214:85; Interrogation_Position=587; Antisense; AGTGTACGAGAGTCGGTCGCATCCG
>probe:Drosophila_2:1625186_at:257:503; Interrogation_Position=602; Antisense; GTCGCATCCGGATTTCGTCAATCAG
>probe:Drosophila_2:1625186_at:512:567; Interrogation_Position=631; Antisense; GGCACGCCCTCAAATTCAAGCGAAT
>probe:Drosophila_2:1625186_at:605:389; Interrogation_Position=657; Antisense; GAAACGATTGTGTTCTTCGGACCCT
>probe:Drosophila_2:1625186_at:348:263; Interrogation_Position=692; Antisense; CAGCTCCTTGGAGTTCTTTGGGAAC
>probe:Drosophila_2:1625186_at:225:593; Interrogation_Position=710; Antisense; TGGGAACTACAACGTTTCGCTTAAG
>probe:Drosophila_2:1625186_at:184:451; Interrogation_Position=735; Antisense; GATCGCAAGCTGATAGCCGTGGGCA
>probe:Drosophila_2:1625186_at:50:291; Interrogation_Position=803; Antisense; CGGAGTCGTGAATGCTGCTGACGTC
>probe:Drosophila_2:1625186_at:109:409; Interrogation_Position=822; Antisense; GACGTCGACCGCCTGATAAATATCA

Paste this into a BLAST search page for me
TAACATTCCAGAATCTTCCGACTCTGACTCTGGGCGATCATGCCGTGAATCAAACAATCTGTGCGATCTGATCGTGATCGTGGAGACGTTTGGACCCAAGCAAGAGGGATCTGCCACTGCTCATGAGTGTACGAGAGTCGGTCGCATCCGGTCGCATCCGGATTTCGTCAATCAGGGCACGCCCTCAAATTCAAGCGAATGAAACGATTGTGTTCTTCGGACCCTCAGCTCCTTGGAGTTCTTTGGGAACTGGGAACTACAACGTTTCGCTTAAGGATCGCAAGCTGATAGCCGTGGGCACGGAGTCGTGAATGCTGCTGACGTCGACGTCGACCGCCTGATAAATATCA

Full Affymetrix probeset data:

Annotations for 1625186_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720